Using the genetic code, interpret the following set of nucleotides. AUGGGUCCAUGGCGUAGGCCAAAUGAUGAGGAAUGA

Q: What is the corresponding RNA sequence, if the DNA sequence reads TACACCTGG?

A: The RNA or ribonucleic acid is single stranded macromolecule that is composed of nucleotides. RNA is…

Q: DNA sequence

A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…

Q: Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that…

A: The sequence of protein is usually notated as a string of letters, according to the order of the…

Q: Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change…

A: Mutations are the abrupt changes in the DNA sequences due to wrong reading of the DNA polymerase…

Q: Draw the following trinucleotide: pGAU

A: A nucleotide is composed of a nitrogen base, a pentose sugar and a phosphate group. A trinucleotide…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: The Universal Genetic Code Table can be used to determine the gene product of a given nucleotide…

A: mRNA consist of mononucleotide sequence that specifies amino acids sequence in peptide chain. One…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: The central dogma is DNA --> mRNA --> Protein. Hence, any mutations in the DNA lead to changes…

Q: What is the consensus sequence of the following six DNA…

A: DNA or the Deoxyribonucleic acid present in both eukaryotes and prokaryotes are made up of millions…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: For the following mRNA sequence (reading from left to right) what will be the amino acid sequence…

A: The knowledge included in the mRNA, which is created by replicating DNA, instructs the cell on the…

Q: Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’…

A: Gene is the basic unit of heredity. All living organisms contain nucleic acid in their nucleus as…

Q: Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the…

A: Introduction The process of duplicating a DNA molecule is known as DNA replication. When a cell…

Q: give the amino acids specified by the following bacterial mRNA sequences. a. 5′…

A: In the given question, the bacterial mRNA sequence is given for which we have to find the amino…

Q: Consider the following wild-type double-stranded DNA sequence: 5' TATGAA AGT3 non-transcribed strand…

A: A gene mutation that results from the substitution of one base pair of another. TATGAAAGT non…

Q: The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown…

A: The objective of the question is to identify the coding and template strands in the given DNA…

Q: Ôn the space provided, type the translation product of wild-type gene A (use three- letter…

A:

Q: Identify which regions of DNA encode the protein sequence. Consider that there may be introns (which…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using…

A: Introduction  Gene expression is the process through which a gene's information is utilised in the…

Q: Transcribe the following DNA sequence into codons.…

A: Transcription is a process in which there is formation of messenger RNA from the DNA template In…

Q: t the following DNA sequences to RNA sequences. Sequence # 1:…

A: Transcription is a process where the DNA is read and an mRNA transcript is synthesized. This mRNA…

Q: Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphate

A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polynucleotides, i.e., they are polymers…

Q: Use the following DNA sequence, and write the resulting messenger RNA sequence

A: When DNA makes it's two copies then this is called replication. When DNA is converted into RNA then…

Q: Provide the abbreviation for the amino acid sequence expected from the following MRNA segment using…

A: Following amino acid sequence is predicted.

Q: Transcribe the following DNA sequence.  Then translate the resulting mRNA transcript.…

A: Mutation is any change in the DNA sequence. It can alter the protein sequence because the proteins…

Q: ACCUAACGCGCCACACGUUCUCUAUUACCCCCC

A: In eukaryotic genes, the coding regions (exons) are interspersed with non-coding regions (introns).…

Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'    Q:  Based on written…

A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…

Q: Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what…

A: Introduction  The process by which a gene's information is used to produce either RNA molecules that…

Q: Give the coordinate for the last base of the first exon for tra-RB; type a number as in 7,000…

A: Introduction :  In mRNA transcripts, introns are referred to as interfering sequences. These are the…

Q: A. For each of the following nucleotide sequences, determine the amino acid sequence. 1. 5'…

A: Introduction Amino acids are molecules that combine to form proteins, They build muscles, prevents…

Q: For the following DNA bases, give the complementary mRNA code that would be transcribed from these…

A: The process of formation of m RNA with the help of DNA is called transcription. During the formation…

Q: * Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG…

A: Anticodons are nucleotide sequences that are the opposite of codons. They're located in tRNAs, and…

Q: Identify the open reading frame for the following sequence: CACAGCCTACTAATGGTGTTGGCTAT Note: When I…

A: To identify the open reading frame (ORF) in a given DNA sequence, we need to locate the start codon…

Q: Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino…

A: Transition refers to a point mutation that changes a purine nucleotide to another purine or a…

Q: If a codon GCA codes for the amino acid alanine in a prokaryote, what will it code for in a…

A: Genetic code refers to the triplets of nucleotides each of which code for a specific amino acid. The…

Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…

A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…

Q: Interpreting Diagrams: Understanding the Main Ideas

A: The DNA is the genetic material of organisms like humans. The DNA is transcribed to RNA by the…

Q: Using the codon charts in your text (section 6.1), fill in the chart below. [  /8]   Original DNA…

A: The gene expression in the cells is brought about by the various processes of Replication…

Q: For each of the following sequences, rank them in order (from best to worst) as sequences that could…

A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…

Q: a) Create its complementary strand. b) Show 3 different types of mutation that can happen to this…

A: Humans and nearly all other species contain their genetic information in DNA, also known as…