Transcribe the following DNA sequence into codons.  TACGCGACATTACATGAATCGTTTGGAGATTAGCCCTATTTCTCTAAGAACACGACT b) Excise(cut out) codons numbered 5, 6, and 7. Leave the remaining codons. c) Now translate the sequence .  d) Explain how many amino acids are now in your polypeptide?  e) What would happen to your polypeptide if either of your cysteine amino acids near the start or end of the polypeptide were translated incorrectly.  f) Based on your final polypeptide can you make the original DNA strand by doing reverse translation and transcription?  g) Explain if your polypeptide similar to your template strand or the complementary strand?

Q: if there are multiple start condo, how can you identify the real start codon? a) By observing…

A: The DNA or RNA sequence consists of three nucleotides and determines the particular amino acid that…

Q: Which of the following types of enzymes is primarily responsible for setting up the genetic code?…

A: Enzymes are the biocatalyst ,which increases the rate of chemical reactions in the body.Most of the…

Q: Yeast have 8 similar tRNA genes with the anticodon 5’-GUA. A researcher mutates one of these genes…

A: Tranafer RNA helps in transporting amino acid as per the instructions given by messenger RNA during…

Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…

A:

Q: Which of the following parts of translation is significantly different in eukaryotes and…

A: mRNA or messenger RNA carries genetic information as nucleotide sequence copied from template DNA…

Q: Using a table that shows which codon represents which amino acid determine the following:   A)…

A: The three nucleotide sequence either DNA or RNA is called codons.During protein synthesis, it codes…

Q: b) What is the MRNA sequence that would be created from the DNA template sequence above?…

A: Cell is the basic structural and functional unit of life. All the cells contains the nucleus with…

Q: Yeast have 8 similar tRNA genes with the anticodon 5'-GUA. A researcher mutates one of these genes…

A: Original Codon Decoded: The complementary codon to the anticodon was first decoded by the tRNA…

Q: 3) During charging of tRNAS Select an answer and submit. For keyboard navigation, use the up/down…

A: The translation is a process by which proteins are synthesized. It is the last step of the central…

Q: Which of the following anticodons can recognize BOTH codons for Aspartate (Asp)? Question 36…

A: The deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…

Q: Which of the following is the correct tRNA anticodon for the Methionine codon (5'-AUG-3'). Hint:…

A: t RNA is the transfer RNA. The main function of transfer RNA is to carry amino acid on its amino…

Q: Chloramphenicol blocks the peptidyl transferase reaction on ribosomes. The specific effect of this…

A: Transcription:  It is the process of formation of RNA transcript from DNA template by the enzyme DNA…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: amino acids are covalently linked to tRNAs via what  a) phosphodiester bond  b) premature…

A: Protein synthesis is governed by the genes which are present on the chromosomes. The genes are first…

Q: 1a) Name the start codon and the three stop codons for translation. 1b) What amino acid is…

A: An mRNA codon is a triplet or triple-nucleotide sequence that codes for a certain amino acid during…

Q: After sequencing a segment of DNA you identify the following sequence: 5…

A: Answer: DNA sequence : It is the genetic sequence or the order of nucleic acids in DNA.  DNA…

Q: 2) If there were 75 naturally occurring amino acids then what is the smallest codon size? A) 1 B) 2…

A: A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid or stop…

Q: 1. The genetic code is redundant (degenerate) what is meant by this statement?   a) the genetic code…

A: Genetic code is the code table made in 1960s by Nirenberg and Khurana et al. They established that…

Q: The following is a portion of an mRNA sequence:   3’ –AUCGUCAUGCAGA-5’ a)During transcription, was…

A: The synthesis of RNA (ribonucleic acid) from DNA (deoxyribonucleic acid) by the enzyme RNApolymerase…

Q: An mRNA has a sequence 3'-AAAUUACUCGAAAUUGCGUGUAGU5'. a) What would be the DNA, t-RNA and amino acid…

A: Points to know  : The fundamental process of protein synthesis is the formation of peptide bond…

Q: The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome:…

A:

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Which of the following is a possible consequence of a mutation that introduces a premature stop…

A: The stop codons are the specific genetic codon that do not codes any amino acids during the…

Q: Select the description of an intron. (If possible, please explain why it is that answer)  a.)…

A: Pre-mRNA contains both introns and exons in it's sequence. This pre-mRNA then undergoes modification…

Q: a) DNA fragment with instructions b) code c) is transcribed but not translated d) non-coding e)…

A: DNA, or deoxyribonucleic acid, is a molecule that contains the instructions an organism needs to…

Q: 14) Why are telomeres so important in eukaryotic organisms: A) Without telomeres, important DNA…

A: Telomeres are the section of a chromosome that is found at the end and does not contain any genetic…

Q: During translation elongation, in which site do new tRNAs enter?   a) D site b) E site c) A site…

A: DNA => Transcription => mRNA => Translation => Protein. Protein synthesis ( ribosome…

Q: Use your genetic code (codon) table to answer the next two questions: What type of mutation would…

A: The answer to the above question is given below.

Q: Which of the following mutations of the DNA sequence TTT TÁC ÁCT would potentially have the least…

A: The genetic information from the DNA is first transcribed into mRNA. The mRNA contains codons, which…

Q: is the MINIMUM number of tRNA's needed to recognize all of the codons for glutamate (Glu)

A: Deoxyribonucleic Acid (DNA) is made up of four main bases, also known as nucleotides. These are -…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: Transcription is the process in which RNA is synthesized from DNA.

Q: What type of damage does UV light do to DNA?

A: 1) What UV light or Radiation must be doing to cells or DNA?

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.