Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same. The protein will be slightly different from the original version, and may be non-functional, fully functional, or partially functional.
DNA and RNA
Deoxyribonucleic acid (DNA) is usually called the blueprint of life. Deoxyribose is a monosaccharide that has a key function in the synthesis of deoxyribonucleic acid. One less oxygen-containing hydroxyl group occurs in deoxyribose sugar. Nucleic acid, deoxyribonucleic acid, is one of the natural components. Deoxyribonucleic acid is a double-stranded molecule. Watson and Crick postulated the double-stranded model of the helix. A deoxyribonucleic acid is a molecular group that carries and transmits genetic information from parents to offspring. All eukaryotic and prokaryotic cells are involved.
DNA as the Genetic Material
DNA, or deoxyribonucleic acid, is a long polymeric nucleic acid molecule discovered in the late 1930s. It is a polymer; a long chain-like molecule made up of several monomers connected in a sequence. It possesses certain characteristics that qualify it as a genetic component. Certain organisms have different types of nucleic acids as their genetic material - DNA or RNA.
Genetics
The significant branch in science which involves the study of genes, gene variations, and the organism's heredity is known as genetics. It is also used to study the involvement of a gene or set of genes in the health of an individual and how it prevents several diseases in a human being. Thus, genetics also creates an understanding of various medical conditions.
DNA Replication
The mechanism by which deoxyribonucleic acid (DNA) is capable of producing an exact copy of its own is defined as DNA replication. The DNA molecules utilize a semiconservative method for replication.
Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below).
Original sequence (coding strand):
AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases]
New sequence:
AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases]
UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a
What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)?
|
The protein will be very different from the original version, and likely non-functional. |
||
|
The protein will be cut short, ending after the first amino acid. |
||
|
There will be no protein produced at all. |
||
|
No change – the protein will be the same. |
||
|
The protein will be slightly different from the original version, and may be non-functional, fully functional, or partially functional. |
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
