Consider the following gene with their respective introns and exons   5’ – TCATGCATTTTGCGCGGGAAATAGCTCA – 3’ 3’ – AGTACGTAAAACGCGCCCTTTATCGAGT – 5’ Using the bottom as a template strand, create: A. A primary mRNA transcript B. A processed mRNA transcript C. Highlight where your START and STOP codons are in your processed transcript (if there are any).  D. The resulting protein sequence

Q: Explain the term polycistronic mRNA.

A: An m RNA that can encode for many proteins is known as polycistronic m RNA.. This m RNA is present…

Q: Discuss the two steps involved in RNA processing. Please explain each step in 2-3 sentences only.

A: In Eukaryote, mRNA produced during the transcription process is known as pre-mRNA. They undergo…

Q: List the general categories of intercellular messengers and brieflydescribe how they differ?

A: Chemical messengers are the substances that deliver the signals.

Q: To test whether you understand the processes involved in the Central Dogma of       Molecular…

A: The synthesis of RNA from the DNA is known as transcription and they synthesis of protein from the…

Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…

A:

Q: 5'-ATGGAATTGGCATGGTTTACCCGTGATGGT-3' 3-ТАССТТААСCGTACCAAATGGGCACTACСА-5' 1. Determine the sequence…

A: Since we answer the first question in case of multiple questions. If you want any specific question…

Q: A). What is the amino acid sequence of the polypeptide produced from a eukaryotic gene that has the…

A: Transcription  The process on making mRNA from DNA which further get translated into polypeptide…

Q: 1 tctagagtca tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca…

A: Forward Primer:5'-TCTAGAGTCAATGAAACAACA-3'Explanation:This sequence starts with the same…

Q: AAUCCCAAU ITTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the…

A: Telomeres are the structures(caps) that are present at the end of the chromosomes, their fhbction is…

Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…

Q: A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAA…

A: Mutation is defined as the sudden and permanent change in the nucleotide sequence of DNA.  Missense…

Q: A eukaryotic gene has two introns and three exons. The first intron closest to the promoter is 157…

A: To draw the structure of the hybridized mRNA and estimate the size of the protein coded for by this…

Q: A molecular geneticist hopes to find a Gene in human liver cell that codes for an important…

A: In heredity, gene occupies the basic physical and functional unit. They are found to be composed of…

Q: 1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 -…

A: The base-pairing rule in DNA is that cytosine (C) pairs with guanine(G) and adenine (A) pairs with…

Q: Which of the following represents the sequence of an RNA transcript for which the template strand of…

A: The deoxyribonucleic acid (DNA) is the nucleotide sequence that stores the genetic information of an…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: The central dogma is DNA --> mRNA --> Protein. Hence, any mutations in the DNA lead to changes…

Q: Below is the template DNA sequence for an entire (short) gene that contains no introns. TRANSCRIBE…

A: The Central Dogma of Biology  DNA --(Transcription)-- RNA --(Translation) -- Protein  It says that…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The translation is a process through which the mRNA, transcribed from the template strand of the…

Q: DNA from a eukaryotic gene was isolated, denatured, and hybridized to the mRNA transcribed from the…

A: The observed diagram is the digramatic representation of the ongoing splicing process. Splicing is a…

Q: Consider the following wild-type double-stranded DNA sequence: 5' TATGAA AGT3 non-transcribed strand…

A: A gene mutation that results from the substitution of one base pair of another. TATGAAAGT non…

Q: LIOCTOTmats Provide the three-letter amino acid sequence expected from each of the following mRNA…

A: Question - 1- Provide the three-letter amino acid sequence expected from each of the following mRNA…

Q: A small section of a gene for a protein has the following nucleotide sequence: TAT AGG GAC CTA TGT…

A: A small section of a gene for a protein has the following nucleotide sequence that codes for the…

Q: You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA…

A: The restriction endonuclease are responsible for cutting the DNA at specific sequence and they…

Q: Complete each of the following statements by selecting from the bank of terms below. a. tRNA b.…

A: 81)Redundancy 82)Universal  83)Elongation  84)Promotor 85)RNA processing  86)snRNA 87)tRNA

Q: Use the sequence from the pre-mRNA shown below to answer the following question.…

A: Introduction :  The GU (5' splice site) and AG (3' splice site) recognise splice sites, signalling…

Q: Where and for what reason (s) are you likely to observe the letter "N" in your Sanger sequence…

A: Sanger sequencing, also known as chain-termination sequencing, is a method for determining the…

Q: In 1964, Nirenberg and Leder used the triplet binding assay to determine specific codon assignments.…

A: In 1964 Nirenberg and Philip Leder, a postdoctoral fellow at NIH, discovered a way to determine the…

Q: The template strand of wild- type gene A is shown below. On the space provided, type the translation…

A: Translation is the formation of protein from mRNA. mRNA is a sequence of ribonucleotides which…

Q: The sequence of mRNA made using the DNA double helix shown below is (Select ] The sequence of…

A: Introduction Protein synthesis is a two step process. In the first step, a molecule of mRNA is…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: This activity will use the Human β-hemoglobin gene, which is mutated in sickle cell anemia, with the…

A: In order to provide good quality answers and keep with the site regulations, the first three parts…

Q: a. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and…

A: The given DNA, 5'- ATGTCGACGCGCAGGTGA - 3' 3' - TACAGCTGCGCGTCCACT - 5'

Q: Although techniques are available for determining the sequences of amino acids in proteins, it is…

A: It is easier to sequence proteins indirectly by determining the base sequence of the gene for…

Q: Define the following terms: a. open reading frame b. degenerate coding system c. nonoverlapping…

A: Note: Since you have posted a question with multiple subparts, we will solve the first three…

Q: You are studying a eukaryotic gene in which translation normally begins at the second AUG in the…

A: Self-explanatoryPlease give me a helpful rating if you are satisfied with my answer

Q: A small section of a gene for a protein has the following nucleotide sequence: GGC TCG GTA ACA TAC…

A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.