A eukaryotic gene has two introns and three exons. The first intron closest to the promoter is 157 bp long and the second, farthest from the promoter, is 236. The three exons, in sequence from closest to farthest from the promoter, are 213 bp, 180 bp and 423 bp respectively. Draw the structure you would obtain if you hybridized the template strand of the transcribed region of this gene and three hundred base pairs of additional flanking DNA at each end with the mRNA produced from this gene. Can you estimate the size in amino acid residues of the protein coded for by this gene? Please justify you answer.

Q: You are studying a large eukaryotic gene that is 439,515 base pairs long. You find the polypeptide…

A: As proteins are polymers of amino acids, the chemical composition of the amino acid side chains and…

Q: Exons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respectively. The introns 1 and 2 are…

A: Introduction :- Exons are the coding regions of an RNA transcript or the DNA that codes for it that…

Q: A gene contains 30% thymine. What is the percentage of pyrimidines present in this segment? Explain.

A: Purines and pyrimidines are chemical molecules that play a role in the production of DNA and RNA and…

Q: With a few exceptions, interspersed repetitive DNA in the human genome has no known biological…

A: Human genome: The term human genome refers to the complete set of genetic instructions or DNA that…

Q: Certain repeated sequences in eukaryotes are flanked by short direct repeats, suggesting that they…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Recombination signal sequences are conserved heptamer and nonamer sequences that flank the V, J, and…

A: Introduction: RAG 1 & 2 are the recombination activating genes that encode a portion of a…

Q: Introns in eukaryotic protein-coding genes may be quite large, but almost none are smaller than…

A: An intron is any nucleotide sequence within a gene that is removed by RNA splicing during maturation…

Q: Suppose that the diagram below represents the genomic organization of an enzyme involved in eye…

A: Transcription is the process by which  RNA transcript is formed from DNA. Various type of RNA are…

Q: Your PhD thesis advisor has given you the task of preparing a human genomic DNA library.  3a. How…

A: The length of the human genome is approximately 3.2 billion bases with genes of 20000-25000 protein…

Q: You obtain the DNA sequence of a mutant of a 2-kb gene in which you are interested and it shows base…

A: the mutation is the change or error that is caused in the chromosome it is of a different type 1.…

Q: The E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition…

A: E.coli is a type of bacteria that normally lives in the intestine. It is also found in the gut of…

Q: Given that there are about 20,000 human genes, how can human cells make 75,00o-100,000 different…

A: Given questions: How human cells make different proteins Difference between missense and nonsense.…

Q: (d) Let's suppose (I'm not saying they are; you figured that out in the question above) that the…

A: The eukaryotic genes are interrupted. The pre-mRNA contains exons and introns. The introns are…

Q: Some RNA molecules are covalently modifi ed by methylation at the N6 position in adenosine residues.…

A: Methylation of DNA is a process of covalent modification, in which at the adenosine nitrogenous…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: Some viruses, such as SV40, contain closed circular DNAs carrying nucleosomes. If the SV40 viral…

A: As we know that viral chromosome is circular in a structure having supercoiled DNA. This…

Q: he Sequence below comes from the alpha-2 globin of the human hemoglobin gene cluster found in…

A: Given: The sequence of the alpha-2 globin of the human hemoglobin gene cluster found in chromosome…

Q: Based on the alignment of these protein sequences below, which [pairs] of the genes appear to be…

A: Based on the alignment of the protein sequences provided in the image, it appears that: SEQUENCE 2…

Q: A hypothetical map of a 10,000 bp (base pair) segment of a human chromosome is shown (1 kbp= 1,000…

A: In this experiment, DNA from two different individuals, Individual 1 and Individual 2, is extracted…

Q: 5'-TTAGGGAACCCTCACTGAATGAATGAATG AATGAATGAATGAATGAATGAATGAATGAATGTTTGGGCAAATAAACGCTG-3' Re-type (or…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: Duchenne muscular dystrophy is caused by a mutation in a gene that comprises 2.5 million base pairs…

A: Dystrophin gene the largest known human gene provides instructions for making a protein called…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.