Exons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respectively. The introns 1 and 2 are 546 bp and 466 bp respectively. a. Draw this gene showing the promoter, exons, introns and transcription initiation sites. b. This gene is found to encode two mRNAs. One of these mRNAs is 224 bp in shorter than the other. i. What is the biological process giving rise to this phenomenon called? What are the sizes of the two mRNAs (in bp) produced from this gene?

Exons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respectively. The introns 1 and 2 are 546 bp and 466 bp respectively. a. Draw this gene showing the promoter, exons, introns and transcription initiation sites. b. This gene is found to encode two mRNAs. One of these mRNAs is 224 bp in shorter than the other. i. What is the biological process giving rise to this phenomenon called? What are the sizes of the two mRNAs (in bp) produced from this gene?

Name: Exons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respecti
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Exons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respectively. The introns 1 and2 are 546 bp and 466 bp respectively.a. Draw this gene showing the promoter, exons, introns and transcription initiationsites.b. This gene is found to encod

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 12TYU

See similar textbooks

Similar questions

A human gene was initially identified as having three exons and two introns. The exons are 456, 224, and 524 bp,whereas the introns are 2.3 kb and 4.6 kb.a. Draw this gene, showing the promoter, introns, exons,and transcription start and stop sites.b. Surprisingly, this gene is found to encode not onebut two mRNAs that have only 224 nucleotides incommon. The original mRNA is 1204 nucleotides, andthe new mRNA is 2524 nucleotides. Use your drawing
A human gene was initially identified as having three exons and two introns. The exons are 456, 224, and 524 bp, whereas the introns are 2.3 kb and 4.6 kb.a. Draw this gene, showing the promoter, introns, exons, and transcription start and stop sites.b. Surprisingly, this gene is found to encode not one but two mRNAs that have only 224 nucleotides in common. The original mRNA is 1204 nucleotides, and the new mRNA is 2524 nucleotides. Use your drawing
Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?
The hunchback gene contains a 5′ transcriptional regulatory region, a 5′ UTR, a structural region (the coding sequences), and a 3′ UTR.a. What important sequences required to controlhunchback gene expression are found in the transcriptional regulatory region of hunchback?b. What sequence elements that encode specific protein domains are found in the structural region ofhunchback?c. Another important kind of sequence is located inthe 3′ UTR of the hunchback mRNA. What mightthis sequence do?
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
In the human enzyme encoded by the DCXR gene, a mutation in the protein coding region of the DCXR gene is described as 583 AC (deletion of 1 nucleotide at position +583). At the protein level, the mutation would be described as: a. a nonsense b. a missense c.
Mutations that occur at the end of a gene may alter the sequence of the gene and prevent transcriptional termination. A. What types of mutations would prevent ρ-independent termination? B. What types of mutations would prevent ρ-dependent termination? C. If a mutation prevented transcriptional termination at the end of a gene, where would gene transcription end? Or would it end?
Consider the following gene with their respective introns and exons 5’ – TCATGCATTTTGCGCGGGAAATAGCTCA – 3’ 3’ – AGTACGTAAAACGCGCCCTTTATCGAGT – 5’ Using the bottom as a template strand, create: A. A primary mRNA transcript B. A processed mRNA transcriptC. Highlight where your START and STOP codons are in your processed transcript (if there are any). D. The resulting protein sequence
The following figure represents the primary transcript of a typical eukaryotic protein-coding gene: Polyadenylation site Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 bp: 1 50 600 945 1205 1393 1725 a. What is the size in bases of the fully processed, mature mRNA? Assume a poly (A) tail of 200 adenine residues in your calculations. b. This primary transcript is responsible for the production of a 294 amino acid protein in the liver and a 270 amino acid protein in the brain. Explain how this is possible. 2.
DNA from a eukaryotic gene was isolated, denatured, and hybridized to the mRNA transcribed from the gene; the hybridized structure was then observed with an electron microscope. The adjoining diagram shows the structure that was observed. a. Identify and label the exons and introns in this hybridized structure.
DNA from a eukaryotic gene was isolated, denatured, and hybridized to the mRNA transcribed from the gene; the hybridized structure was then observed with an electron microscope. The adjoining diagram shows the structure that was observed. a. How many introns and exons are there in this gene? Explain your answer.
Trinucleotide repeat expansions (TNREs) are associated with severaldifferent human inherited diseases. Certain types of TNREsproduce a long stretch of the amino acid glutamine within theencoded protein. When a TNRE exerts its detrimental effect byproducing a glutamine stretch, are the following statements true orfalse?A. The TNRE is within the coding sequence of the gene.B. The TNRE prevents RNA polymerase from transcribing thegene properly.C. The trinucleotide sequence is CAG.D. The trinucleotide sequence is CCG.