A monocistronic mRNA is defined by… Group of answer choices The presence of a 5’ triphosphate The absence of introns The presence of one coding sequence The absence of a poly(A) tail   Eukaryotic mRNAs are protected on the 5’ end by… Group of answer choices A methylated guanosine A polymer of adenine A triphosphate RNA primer   Eukaryotic mRNAs are typically processed in this order: Group of answer choices Introns spliced out, poly(A) tail added, capped Poly(A) tail added, capped, introns spliced out Capped, poly(A) tail added, introns spliced out Capped, introns spliced out, poly(A) tail added

Q: Help me figure out how I should interpret and read these graphs. We are looking to see whether the…

A: The regulation of RNA splicing is a complex process that involves the interaction of multiple…

Q: ture MRNA. What are these modifications and what are their significance? Use = following terms to…

A: When introns are eliminated and the mRNA is regarded suitable for translation, eukaryotic pre-mRNA…

Q: Based on your know | (hir sequence.

A: In many eukaryotic (and other prokaryotic) genes, the original RNA extracted from a genetic DNA…

Q: The gene ABCD is 1500 bases long.  Answer the following questions:   What would be the likely…

A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…

Q: Transcribe the given DNA sequences to mRNA. DNA: 5'-CGCCTAG-3' mRNA: 3'- DNA: 5'-AATGCGATT-3' mRNA:…

A: Both DNA and mRNA are nucleic acids that are required for gene expression and protein synthesis. DNA…

Q: The deadenylation pathway is a critical means of maintaining a steady state level of mRNAs and…

A: The deadenylation pathway is a cellular process that involves the shortening or removal of the…

Q: Indicate which of the following items are associated with transcription or translation.  This could…

A:

Q: The following double stranded segment of DNA is part of a protein coding gene. The segments in…

A:

Q: One procedure of obtaining cDNA from mRNA is by using oligo(dT) primers. What are oligo(dT)s? Why…

A: oligo(dT)are  primer widely used for cDNA the synthesis generation of a high frequency of…

Q: In eukaryotes, the initial transcript, pre-mRNA, must be modified in three ways before it leaves the…

A: The premature mRNA (pre-mRNA) are produced from the DNA template strand within the nucleus of…

Q: a) Two of the following three mRNA sequences code for the same protein.  Delete the sequence which…

A: Translation is defined as the process where the nucleotide sequence in the mRNA is translated to…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: . The human gene for ß2 lens crystallin has the components listed below. The numbers represent…

A: Since we only answer up to 3 sub-parts, we’ll answer the first three. Please resubmit the question…

Q: Which of the following feature of mature mRNAs protects them from premature degradation by cellular…

A: Introduction  Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that matches to a…

Q: Which mRNA sequences would form a structure that is a cue for transcription termination of some…

A: The ending of termination and the process involved in it are called transcription termination. The…

Q: Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’…

A: Gene is the basic unit of heredity. All living organisms contain nucleic acid in their nucleus as…

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…

A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…

Q: Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene:…

A: The double-stranded DNA molecule is made up of two DNA strands known as the template strand and the…

Q: The asterisk (*) in the diagram below indicates a single base mutation in the 5' splice site of the…

A: Splicing is one of the most important modifications which take place during mRNA maturation. There…

Q: NASA has identified a new microbe present on Mars and requests that you determine the genetic code…

A: Introduction RNA is an abbreviation for ribonucleic acid, a nucleic acid found in all living cells.…

Q: Consider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for…

A: The original mRNA sequence:5'-UUG ACC GAC-3'To determine the amino acid sequence, it is important to…

Q: The stability of eukaryotic mRNAs can generally be enhanced by which of the following? Presence of…

A: The mRNA (messenger RNA) is used in the translation process for the production of proteins…

Q: Eukaryotic mRNAS have a 5' end while prokaryotic mRNAs do not. O IV.

A: Ans- D Explanation- Eukaryoticic and prokaryotic mRNA are two different mRNAs. Prokaryotic mRNA is…

Q: 5' cap amino acid aminoacyl tRNA synthetase anticodon codon EF-Tu-GTP EF-Ts eukaryote Kozak…

A: Three process combined together to form a central dogma that is replication where copy of genetic…

Q: Translate the following mRNA: 5-A U G A A A U U U C U U U A G G U C G A A -3     NH3+-…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Where would you find the base pairs that constitute the promoter? h. Which intron interrupts the 3′…

A: Base pairs that constitute the promoter are located at the 5' end of the UTR region. Promoter are…

Q: 1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that…

A: The amino acids in the given sequence are leucine, tyrosine, glycine, glycine, and valine.

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: A normal mRNA that reads 5'- UGCCAUGGUAAUAACACAUGAAGGCCUGAAC-3' was an insertion mutation that…

A: mRNA Messenger RNA or mRNA, it is a single-stranded RNA molecule that is coded into chain of peptide…

Q: Your labmate gives you a gene with the following sequence of the coding strand for the first 5 amino…

A: given DNA strand first form the complimentary starnd by changing A - T and G-C for the strand 3' to…

Q: Describe the prokaryotic translation initiation shown in the diagram. Define the convention of…

A: In bacteria initiation factor are required .Initiation factor 3(IF3) prevents 30S subunit binding to…

Q: What is the purpose of the underlined sequence?   5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG…

A: In molecular biology, understanding the purpose of specific nucleotide sequences is crucial for…

Q: translation

A:

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.