The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1) Find the sequence of the MRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5' end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!

Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…

A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…

Q: A) Draw the mRNA to be translated if the pre-mRNA is constitutively spliced. [ 3) Draw an mRNA to be…

A:

Q: Assume the following DNA template strand: 3'-ATA GCG AGG AGT ATC-5' A) What would be the protein…

A: Introduction  A mutation is a change in the structure of a gene, which is the fundamental unit of…

Q: in transcription, if the gene to be transcribed is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the…

A: Transcription is the process that involves the synthesis of an RNA molecule from DNA. It is the…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What…

A: Gene expression is the process by which the instructions in our DNA are converted into a functional…

Q: A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAA…

A: Mutation is defined as the sudden and permanent change in the nucleotide sequence of DNA.  Missense…

Q: Transcribe the given DNA sequences to mRNA. DNA: 5'-CGCCTAG-3' mRNA: 3'- DNA: 5'-AATGCGATT-3' mRNA:…

A: Both DNA and mRNA are nucleic acids that are required for gene expression and protein synthesis. DNA…

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…

Q: The following sequence represents a few codons present in one strand of DNA.Using this strand of DNA…

A: DNA replication is the process of formation of copies of DNA. It takes place in nucleus of cell.…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Mutation is the sudden change in the base pair of sequence resulting in altered phenotype. The…

Q: The following double stranded segment of DNA is part of a protein coding gene. The segments in…

A:

Q: None

A: a) The informational strand (also known as the coding strand) of DNA is complementary to the…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: A nucleotide sequence in a segment of a DNA information strand is given here. Sketch (A) the…

A:

Q: After sequencing a segment of DNA you identify the following sequence: 5…

A: Answer: DNA sequence : It is the genetic sequence or the order of nucleic acids in DNA.  DNA…

Q: 3' A TAT --IIL 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 DNA C GU UGA UG G MRNA TRNA Amino…

A:

Q: None

A: The given DNA3' CACTACGGCGCTGCGTGACCGATCACAGTGCGT 5' 5' GTGATGCCGCGACGCACTGGCTAGTGTCACGCA 3'  In the…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Below is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first…

A: DNA DNA is a genetic material from which amino acid sequence or polypeptide chain are made.

Q: For this double stranded DNA: 3’-AGGTCCAGTCTTCGGCGGATGATCGGGCCAACCCCCGTAACTGGTCACCGGAATGCC-5’…

A: 4 codes are used by the DNA that areAdenine (A), Thymine (T),  Guanine (G), Cytosine (C)RNA also…

Q: a) The following nucleotide sequence is found on the template strand of DNA: 3' - TAC TGG CCG TTA…

A: We are answering four parts  For rest of parts pls repost.

Q: if the following DNA sequence were transcribed, which of the following describes the output of this…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and…

A: FGF3 gene is responsible for producing a protein called fibroblast growth factor 3 which is a part…

Q: 5 to 3 direction, the DNA template strand should be  5'TTT-GGG-AAA-3'

A: mRNA and DNA are two types of nucleic acids that play crucial roles in gene expression and protein…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.