The following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. Draw or write-out a) the sequence of the primary transcript and b) the mature mRNA resulting from this stretch of DNA.

Q: Consider this list (below) of steps involved in transcription. These steps are out of order.…

A: Replication, transcription, and translation are used by all cells to keep track of their genetic…

Q: you are given a printout of the sense strand of your DNA.  The printout is shown below. The first…

A: Introduction: DNA is a double helix having a sugar-phosphate backbone like a ladder and the base…

Q: A) Describe each step of the DNA REPLICATION in EUKARYOTIC organisms B) Describe each step of the…

A: Transcription = Re-writing DNA into RNADNA is "transcribed" or re-written into RNA in a very…

Q: The following sequence represents a few codons present in one strand of DNA.Using this strand of DNA…

A: DNA replication is the process of formation of copies of DNA. It takes place in nucleus of cell.…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: In eukaryotes, the initial transcript, pre-mRNA, must be modified in three ways before it leaves the…

A: The premature mRNA (pre-mRNA) are produced from the DNA template strand within the nucleus of…

Q: a) Two of the following three mRNA sequences code for the same protein.  Delete the sequence which…

A: Translation is defined as the process where the nucleotide sequence in the mRNA is translated to…

Q: Tay Sachs disease is an autosomal recessive disease in which a protein – Hex A - is abnormal. To…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: If there are 64 possible codons in the genetic code and the amino acid is specified by each, as read…

A: Protein synthesis is described as the process that ultimately results in the formation of proteins.…

Q: The following DNA fragment was isolated from the beginning of a gene. Determine which strand is…

A: DNA, or deoxyribonucleic acid, is a molecule that carries the genetic instructions necessary for the…

Q: This is a double-stranded DNA sequence—with no introns—that codes for a small protein (this is a…

A: The DNA is transcript into mRNA by the process of RNA transcription with the help of RNA polymerase…

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…

A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…

Q: The asterisk (*) in the diagram below indicates a single base mutation in the 5' splice site of the…

A: Splicing is one of the most important modifications which take place during mRNA maturation. There…

Q: NASA has identified a new microbe present on Mars and requests that you determine the genetic code…

A: Introduction RNA is an abbreviation for ribonucleic acid, a nucleic acid found in all living cells.…

Q: The figure below shows the introns and exons found in gene X. The size of each exon and intron is…

A: In genes  there are two type of sequence in eukaryotic organisms. one is responsible for formation…

Q: Given the Following DNA template, TAC   CGC   TCC   GCC  GTC   GAC   AAT   ACC   ACT, write out the…

A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…

Q: Eukaryotic mRNAS have a 5' end while prokaryotic mRNAs do not. O IV.

A: Ans- D Explanation- Eukaryoticic and prokaryotic mRNA are two different mRNAs. Prokaryotic mRNA is…

Q: The following gene sequence of nucleotides is found on the template (non-coding) strand of a…

A: The sequence would be opposite to template strand and similar to coding strand(except the thiamine…

Q: You are given the following mRNA sequence. You know that it contains some UTR sequence and the…

A: Proteins are defined as polymers of amino acids. As there are 22 standard alpha-amino acids by which…

Q: Once a primary RNA transcript is created from a DNA template, it must be modified in several ways…

A: Introduction :- mRNA stands for messenger RNA. It is a type of RNA molecule that is involved in the…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: Transcription is the process in which RNA is synthesized from DNA.

Q: The primary RNA transcript of the chicken ovalbumin gene is 7700 nucleotides long, but the mature…

A: In molecular biology, RNA splicing is the process by which a newly synthesised precursor messenger…

Q: A graduate student is trying to identify the gene coding for an enzyme found in a bacterial species…

A: Trinitrotoluene (TNT), a solid organic nitrogen chemical that is mostly utilised as an explosive and…

Q: The exons and introns of a gene are shown below. Introns are shown as black bars. Exons are numbered…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Consider the following segment of a template strand of DNA: Part A -АТА AGC TTC GAC What is the MRNA…

A: Transcription is the process of making an RNA copy of a gene sequence known as mRNA by using DNA as…

Q: Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as…

A: Let's rearrange the mRNA in the codes of three.  ACG UCC AAU GGC AGU GAU UUG AAU CCA ACG codes for…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Human wildtype and mutant alleles are identical in sequence except for a single base-pair…

A: A mutation is any change in the DNA sequence of a cell. It may alter one or a few base pairs or…

Q: After an MRNA primary transcript is created, a modified guanine nucleoside triphosphate is added to…

A: The genetic information in a cell is processed in a series of steps namely replication,…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.