Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU   ala-met-stop    ala-met-stop    ala-met-phe    phe-ala-met

Q: Using the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA…

A: Transcription is a process of formation of transcript or RNA from DNA by the process of…

Q: The amino acid sequence of human vasopressin is Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly. Write an mRNA…

A: The given amino acid sequence of human vasopressin is Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly.  3…

Q: TRACE THE CODE| Order of bases in MRNA (codon) AUC Order of bases in ERNA (anticodon) Order of bases…

A: Complete this table of codes.

Q: Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that…

A: The sequence of protein is usually notated as a string of letters, according to the order of the…

Q: Explain why the translation of a given mRNA can be inhibited by a segment of its complementary…

A: A mechanism of reading and decoding the nucleotide sequences of messenger ribonucleic acid (mRNA)…

Q: There are four codons that encode threonine. Consider the leader sequence in Figure 31.22A. What…

A: Threonine is a type of amino acid. Amino acids are the building block of proteins. These are…

Q: In the diagram below, identify the mRNA by clicking on the correct highlighted portion. TACGGGCTA A…

A: Alleles are considered as the variant of the gene. DNA is composed of different nucleotides that…

Q: Aspartate and phenyalanine become apartate and isoleucine

A:

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…

A: The proteins are the final end product of a gene that ultimately determine the characteristics of an…

Q: Explain why the statement is correct. A section of the mRNA has a nucleotide sequence of…

A: mRNA  A single stranded RNA which is copied from DNA and contains gene or information about specific…

Q: Interpret this mRNA strand and determine the proper sequence and shape of this protein:  AUG UCA CGC…

A: Introduction :- When transcription occurs, mRNA is produced. RNA polymerase decodes a single strand…

Q: Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the…

A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure which act as genetic material in…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Missense mutation is the mutation in which single amino acid change occurs. The other amino acid in…

Q: What is the tRNA strand for the following mRNA strand: CAGGAUGAAUUGCUC

A: To determine the tRNA (transfer RNA) sequence corresponding to the given mRNA (messenger RNA)…

Q: An mRNA has the following sequence:5′–AUG UAC UAU GGG GCG UAA–3′.Describe the amino acid sequence of…

A: Transcription DNA is converted to mRNA. this process is called transcription.

Q: (2) (a) Using the codon table, show the consequences of adenine base addition to thebeginning of the…

A: The genetic code is a set of instructions that enable living cells to produce proteins from genetic…

Q: Codons in mRNA molecule and their corresponding amino acids UUU UUA GCA AAG GOU nonsense Refer to…

A: Genetic codes are genetic information present in the nucleotide sequences of mRNA (messenger RNA)…

Q: Given this mRNA strand: 3’ -   AUGAGGAAGGUA   - 5’; what are the components of the polypeptide?

A: Translation is the process in which the genetic message carried by mRNA from the DNA is converted in…

Q: If the DNA sequence is 3’ ATCGACGTC 5’, what is the mRNA sequence

A: DNA is the double helix structure. Two complementary strands present in the DNA. The direction of…

Q: For the following mRNA sequence (reading from left to right) what will be the amino acid sequence…

A: The knowledge included in the mRNA, which is created by replicating DNA, instructs the cell on the…

Q: The following DNA fragment was isolated from the beginning of a gene. Determine which strand is…

A: DNA, or deoxyribonucleic acid, is a molecule that carries the genetic instructions necessary for the…

Q: If the sequence of the coding strand in a transcription unit is written as follows: 5'-…

A: In that question we have to write down the sequence of mRNA.

Q: Ôn the space provided, type the translation product of wild-type gene A (use three- letter…

A:

Q: Use the genetic code table to determine the amino acid sequence of the given message strand of DNA…

A: Proteins are made up of amino acids, which are a type of molecule. The basic components of life are…

Q: Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Describe the steps necessary to synthesize mRNA fromeach of the following: double-stranded DNA,…

A: The synthesis mRNA from double-stranded DNA requires the enzyme RNA polymerase II, this enzyme will…

Q: 9) In another mutation from the original wild-type sequence, the bolded G in the middle of the…

A: The DNA is transformed into proteins through the process of transcription and translation.  The…

Q: In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash…

A: DNA is a genetic material in most of the organism. It is two stranded ladder like structure which…

Q: Write a mRNA sequence for the below nucleotide sequences ATTACACACAGCGCGTATACGCGCGCGGGCTATA

A: The mRNA sequence is considered the template strand used to form the chain of amino acids. A codon…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: What will be the overall anti-codon sequence in tRNA for this mRNA?…

A: Proteins are synthesized from DNA in two step process. These two processes are transcription and…

Q: List the differences in the loading of the tRNA and its alignment with the mRNA between the…

A: Translation It is defined as the process of translating the sequence of mRNA molecules to the…

Q: Translation of mRNA Using the codon chart provided, translate the following messenger RNA sequence…

A:

Q: If the mRNA molecule from your answer to the previous question is going to be translated into a…

A: The gene is the portion of DNA that codes for a specific protein. First, the DNA is converted to…

Q: Examine Table 15-2. What do the following codons specify:a. UAAb. UGAc. UAGWhat happens when a…

A: Step 1 Genetic codes are genetic information present in the nucleotide sequences of DNA…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: In how many cases in the genetic code would it NOT be possible to know the amino acid specified by a…

A: DNA or deoxyribonucleic acid is a double-helical molecule consisting of two polynucleotide chains.…

Q: Assuming that it is exactly and only 5 nucleotides long, write the Shine-Dalgarno sequence in the…

A: Given: The shine- dalgano sequence is a ribosomal binding site that is found in bacterial and…

Q: Write the amino acid sequence based on the following portion of MRNA. Write the name of the amino…

A: The codons which are present on mRNA are will code for specific amino acids based on genetic code…

Q: Complete the box below:     Convert the following template strand of DNA bases into its…

A: The production of RNA from the DNA is known as transcription. This process is also known as gene…

Q: For the following DNA bases, give the complementary mRNA code that would be transcribed from these…

A: The process of formation of m RNA with the help of DNA is called transcription. During the formation…

Q: translation

A:

Q: Given the mRNA sequence ,5’-AUGUACAAGGUCGGAUGA-3’ which of the following amino acid sequence would…

A: The objective of the question is to determine the sequence of amino acids that would result from the…

Q: For Each of your 3 DNA Templates, Fill out the Following: DNA Template # DNA sequence (copy from the…

A: The process of gene expression involves transcribing DNA into mRNA and then translating mRNA into an…

Q: During transcription, a portion of mRNA is synthesized with the following base sequence.…

A: Introduction  Gene expression can only occur when the Gene is transcribed into mRNA and then this…