Given the mRNA sequence ,5’-AUGUACAAGGUCGGAUGA-3’ which of the following amino acid sequence would result from translation? Tyr-met-val-lys-gly Met-val-lys-tyr-gly Met-tyr-lys-val-gly Ser-arg-leu-glu-his-val Gly-met-val-lys-tyr
Q: UAA is a stop codon. Why does the UAA sequence in the segment of mRNA…
A: Stop codons do not specify any amino acid. When ribosome faces any stop codon, it stalls. When the…
Q: A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:…
A: The Central dogma defines how DNA codes for proteins, which occur in three stages: replication,…
Q: A mutation occurred in the DNA sequence during replication. Which of the following, A-D, describes…
A: A mutation occurs when the nucleotide sequence of an organism, virus, or extra - chromosomal DNA is…
Q: MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA…
A: The translation is a process in which the genetic information in the mRNA strand is converted into…
Q: Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the…
A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure which act as genetic material in…
Q: segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following…
A: For protein synthesis, messenger RNA must be made from one strand of DNA called the template strand.…
Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second…
A: The mRNA (messenger ribonucleic acid) is synthesized from a DNA (deoxyribonucleic acid) template.…
Q: What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UUA -GUU-3
A: RNA (Ribonucleic acid) polymerase is the major enzyme responsible for the transcription process in…
Q: Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the…
A: Gene expression is the process by which the instructions in the DNA are converted to functional…
Q: On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in the course of…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Using the genetic code table provided below, write out the sequence of three different possible mRNA…
A: Codons, which are groups of three nucleotides, are read by cells to decode mRNA. The majority of…
Q: Translate the following mRNA: 5-A U G A A A U U U C U U U A G G U C G A A -3 NH3+-…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were…
A: Enzymes can catalyze several reactions and aid in speeding up a reaction. There are several enzymes…
Q: What polypeptide is coded for by this mRNA sequence? 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'
A: Codons are trinucleotide sequence (DNA, RNA) that codes for specific amino acid and chain of amino…
Q: If tRNALeu is mutated so that it is recognized by the tRNAVal synthetase but not the by tRNALeu…
A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic…
Q: Suppose that a protein has the amino acid sequence…
A: Researchers need to take the degeneracy of the genome's code into account to calculate the amount of…
Q: What amino acid sequence is coded for by the mRNA base sequenceCUC-AUU-CCA-UGC-GAC-GUA?
A: The sequence of a protein is notated as a string of letters, according to the order of the amino…
Q: Translate the RNA codons using the given genetic code 5' A-U-C-G-A-C-G-A-U-C-C-G-A-U-C-G-A-U 3'
A: Translation: Translation is the process by which ribosomes in the cytoplasm or endoplasmic…
Q: What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UAA -GUU-3’?
A: m-rna is synthesized in 5' to 3' direction and it used the enzyme rna polymerase and dna template…
Q: If methionine is the first amino acid incorporated into a heptapeptide, what is the sequenc of the…
A: Each group of three bases in a mRNA constitutes a codon. Each codon specifies an amino acid.
Q: Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of…
A: Gene is a hereditary unit which helps in transfer of genetic information. Genetic information is…
Q: Refer to the information on the genetic code. Use this information to determine how many amino acids…
A: The genetic code is a set of rules that living cells use to convert information found in genetic…
Q: What amino acid sequence does the following mRNA nucleotides sequence specify? 5'- AUGGCCAGCUGU…
A: Protein is synthesized via translation of mRNA template by ribosomes in the cytoplasm. mRNA has…
Q: MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA…
A: DNA => mRNA => Protein 64 codons are there for 20 amino acids. That is one amino acid can be…
Q: Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of…
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence:…
A: So the given m-RNA code for - met-glu-ser-leu-leu.
Q: Identify the mRNA codons that could have been used in the protein synthesis process to convert DNA…
A: mRNA is the product of transcription formed from DNA by RNA polymerase. This mRNA is important for…
Q: What is the one-letter amino acid sequence formed from the following mRNA that codes for a…
A: Nucleic acid is a macromolecule which play important role in storage of genetic material and…
Q: Which of the following polypeptides (written from their N terminal ends) is encoded by the following…
A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…
Q: TRP U ARG AC LEU SER U A UG LYS PRO GAC UG GLN HIS THE MET ILE ARG a. lys-leu-cys-phe…
A: The process of the formation of a protein with the help of messenger RNA in the ribosomes is called…
Q: Using the genetic code table provided below, identify the open reading frame in this mRNA sequence,…
A:
Q: Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the…
A: Transcription is the process in which the synthesis of RNA takes place by using deoxyribonucleic…
Given the mRNA sequence ,5’-AUGUACAAGGUCGGAUGA-3’ which of the following amino acid sequence would result from translation?
Tyr-met-val-lys-gly
Met-val-lys-tyr-gly
Met-tyr-lys-val-gly
Ser-arg-leu-glu-his-val
Gly-met-val-lys-tyr
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- If tRNALeu is mutated so that it is recognized by the tRNAVal synthetase but not the by tRNALeu synthetase, how will the following peptide sequence change upon mRNA translation? wild-type: Met-Lys-Leu-Pro-Ala-Leu-Val-Val-Ala O Met-Lys-Leu-Pro-Ala-Leu-Leu-Leu-Ala O Met-Lys-Val-Pro-Ala-Val-Leu-Leu-Ala O Met-Lys-Val-Pro-Ala-Val-Val-Val-AlaA polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly Ala-Ala-Gly-Leu-Trp-Arg Arg-Asp-Pro-Gly-Lue-Met-Val-Leu-Tyr-Ala-Ala-Asp-Glu-Lys And the following fragments are produced by chymotrypsin fragmentation: Ala-Ala-Gly-Leu-Trp Arg-Arg-Asp-Pro-Gly-Leu- Met-Val-Leu-Tyr Ala-Ala-Asp-Glu-Lys-Val-Gly What is the sequence of the whole original polypeptide?A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly Ala-Ala-Gly-Leu-Trp-Arg Arg-Asp-Pro-Gly-Lue-Met-Val-Leu-Tyr-Ala-Ala-Asp-Glu-Lys And the following fragments are produced by chymotrypsin fragmentation: Ala-Ala-Gly-Leu-Trp Arg-Arg-Asp-Pro-Gly-Leu- Met-Val-Leu-Tyr Ala-Ala-Asp-Glu-Lys-Val-Gly What is the sequence of the whole original polypeptide? (Recall that trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas chymotrypsin cleaves after aromatic amino acid residues).
- A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)Translate the RNA codons using the given genetic code 5' A-U-C-G-A-C-G-A-U-C-C-G-A-U-C-G-A-U 3'What amino acid sequence does the following mRNA nucleotides sequence specify? 5'- AUGGCCAGCUGU -3' Express the sequence of amino axis's using the three-abbreviations, separate hyphens (e.g., Met-Ser-Thr-Lys-Gly).
- Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.Translate the following mRNA: 5-A U G A A A U U U C U U U A G G U C G A A -3 NH3+- Met-Leu-Phe-Val- COO- NH3+- Met-Thr-Val-Ser- COO- NH3+- Met-Glu-Gln-Ser- COO- NH3+- Met-Asp-Ser-Pro- COO- NH3+- Met-Lys-Phe-Leu- COO-
- Given the following mRNA sequence, write the peptide sequence that will result from protein translation. Please indicate the correct directionality.Using the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAUTranslate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop