If my final mRNA product sequence is this:CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACGWhat would the final protein product be? (only use the capitalized letters). The image is a circular diagram representing the genetic code used in the translation process of protein synthesis. The wheel is read from the center outward, and it showcases which RNA codons correspond to which amino acids.### Structure of the Diagram:1. **Center Circle:** - Contains the RNA bases: A (adenine), C (cytosine), G (guanine), and U (uracil).2. **First, Second, and Third Position Circles:** - These circular layers help determine the three-base codon sequence for amino acids: - The innermost circle (just outside the center) represents the first base of the codon. - The middle circle indicates the second base. - The outermost circle shows the third base.3. **Amino Acids:** - The outermost layer of the circle lists the amino acids encoded by the codons. Each segment aligns with the three bases forming a codon. - Amino acids are abbreviated by their three-letter codes and one-letter symbols (e.g., Phe - F for Phenylalanine).4. **Start and Stop Codons:** - A triangular symbol indicates the start codon, typically AUG, which codes for Methionine (Met, M). - The presence of a circular symbol denotes stop codons, which are UAA, UAG, and UGA, halting translation.### Function:- This diagram is a tool for translating the mRNA sequence into a protein sequence during the process of translation in cells. Each three-letter RNA sequence corresponds to one of the 20 standard amino acids, a start, or a stop signal. ### Educational Use:- Students can use this wheel to understand how the sequence of mRNA nucleotides is translated into a linear chain of amino acids forming proteins.- It serves as a reference to comprehend codon assignments and the redundancy of the genetic code where multiple codons can specify the same amino acid.

Name: If my final mRNA product sequence is this:CAAGAUGUACUUUGCGACAAGAGAGGAU
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: If my final mRNA product sequence is this:CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACGWhat would the final protein product be? (only use the capitalized letters). The image is a circular diagram representing the genetic code used in the translat