Explain why the statement is correct. A section of the mRNA has a nucleotide sequence of CUATAUGUTGUU. How many codons does this segment of mRNA represent? none, this molecule is not an RNA transcript of DNA
Q: The maximum number of amino acids that coded by 40 nucleotides in the MRNA are
A: mRNA plays a specific role in protein synthesis in the cell.
Q: Compare the two mRNA sequences below. AUAUUCGGCAAUCCG AUAUUCCGCAAUCCG This change could be the…
A: Messenger RNA or mRNA is single stranded RNA which acts as template for the synthesis of amino acids…
Q: Explain why the translation of a given mRNA can be inhibited by a segment of its complementary…
A: A mechanism of reading and decoding the nucleotide sequences of messenger ribonucleic acid (mRNA)…
Q: Shown below is a codon in an mRNA. What is the correct sequence of the tRNA anticodon that…
A: The given messenger ribonucleic acid (mRNA) codon 5’-CAG-3’ codes for the amino acid glutamine.…
Q: Refer to the Table of the Genetic Code and match the type of mutation to the following codon changes
A: Mutation : A mutation is defined as the changes in the nucleotide sequence. These results in…
Q: The figure represents tRNA that recognizes and binds a particular amino acid (in this instance,…
A: Your answer is incorrect and the correct answer is 5'-UUC-3' This is because the amino acid…
Q: Given the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the…
A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…
Q: A mutation that substitutes a nucleotide sequence, such that in the MRNA transcript the original UAA…
A: mRNA serves as a template for the process of protein synthesis.
Q: A segment in the middle of an mRNA has the sequence 5¿- AGAGAACCGCGA-3¿. Using the codon table,…
A: With the help of translation process protein forms. The nucleotide sequence are translated into…
Q: segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following…
A: For protein synthesis, messenger RNA must be made from one strand of DNA called the template strand.…
Q: There are no aminoacyl-tRNAs that will go to the A site of the ribosome when UGA is the codon. Is…
A: During termination of protein synthesis, protein synthesis ends when one of the three stop codons:-…
Q: TRANSLATE this RNA sequence: AUGCAAUGA Met-Gln-Stop Met-His-Stop O Thr-Glu-Stop O Thr-Pro-Stop
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: A gene contains the sequence GGCTAAC. What is the sequence of the MRNA transcribed from this strand…
A: The method of producing an RNA copy of a gene sequence is known as transcription. This duplicate,…
Q: The first amino acid in a purified bacterial protein is methionine. The start codon in the mRNA is…
A: The process of protein(amino acid) formation is called translation and it is the last step of the…
Q: Three bases on MRNA that translate into an amino acid are called:
A: A translation is a process of conversion of mature mRNA molecules into long chains of a polypeptide…
Q: explain why a mutation in the dna nucleotide sequence that corresponds to the 3rd nitrogen base in…
A: A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is…
Q: Sequence of amino acids in protein
A: Protein Synthesis: It is the process of creating protein molecules. There are 5 major steps involved…
Q: If my final mRNA product sequence is this: CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACG What…
A: The central dogma of life states that there is a unidirectional flow of information from master copy…
Q: Choose whether the statement is TRUE or FALSE "There are no aminoacyl-tRNAs that will go to the A…
A: Protein synthesis ends when one of the 3 stop codons :-: UAG (amber) UAA (orchre) UGA(opal) Enters…
Q: An mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start…
A: RNA (Ribo Nucleic Acid) is the genetic material found in prokaryotes and eukaryotes. It is the prime…
Q: Translate the following mRNA into protein, starting from the first initiation codon:…
A: Translation is the process of synthesis of protein from an mRNA. mRNA synthesized through…
Q: What type of RNA corresponds to the statement? Prokaryotic Eukaryotic FRNA MRNA TRNA hnRNA RNA FRNA…
A: RNA or Ribonucleic acid is one among different biomolecules. They are also composed of nucleotides;…
Q: The largest class of introns which are found in nuclear mRNA primary transcript isa) Spliceosomal…
A: Nuclear mRNA primary transcript is a pre-mRNA which is transcribed from a gene and undergoes…
Q: What polypeptide is coded for by this mRNA sequence? 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'
A: Codons are trinucleotide sequence (DNA, RNA) that codes for specific amino acid and chain of amino…
Q: A sequence of mRNA is mutated such that there is no "start" codon. Which of the following is a…
A: The ribosomal binding on the mRNA requires the presence of Shine Dalgarno or kozak sequence upstream…
Q: Complete the following table: Type of RNA Functions Transfer RNA (tRNA) In a ribosome,…
A: Macromolecules are very large molecules commonly composed of the polymerization of smaller subunits…
Q: Why is it essential that tRNA binds to both amino acids & mRNA codon during protein synthesis?
A: Protein synthesis involves translation of mRNA into a protein that requires three complex stages,…
Q: State the direction of movement of the ribosome along the mRNA strand (the direction of…
A: Protein synthesis involves translation of mRNA into protein that requires three complex stages:…
Q: The tollowing mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA…
A: Protein consists of amino acids linked by amide bonds or peptide bonds.
Q: The _______________ catalyzes the excision of introns from pre-mRNA. (a) ribosome (b) spliceosome…
A: Transcription It is the process by which gene's DNA sequence is copied into RNA molecule. It is a…
Q: DNA Sequence mRNA Sequence (codon) tRNA Sequence {anticodon) AMINO ACID Sequence
A: Introduction DNA (Deoxyribonucleic acid)serves as the genetic material of almost all organisms (some…
Q: During transcription, a portion of mRNA is synthesized with the following base sequence.…
A: Introduction Gene expression can only occur when the Gene is transcribed into mRNA and then this…
Q: What type of the mRNA is recognized as a first step of translation initiation in eukaryotes? a TaTA…
A: Translation is the process that results in protein synthesis. It takes place in the cytoplasm. This…
Q: AAA CC GG G CA GG CCGU Phe Gly Arg
A: * Transcription is the process of copying DNA segment into RNA. *The DNA segments transcribed into…
Q: Codon to be read in the mRNA is 5' GAA 3', what is the amino acid? a. E b. K c.F d.L
A: Dear student answer of your question is given below: Given codon in the mRNA is 5' GAA 3' , It…
Q: Which of the following codons in an MRNA can be recognized by the tRNA with UAA anticodon sequence…
A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…
Q: if the sequence of bases in the mRNA Codons is 5' - AUCCUACGU - 3' then the sequence of amino acids…
A: In the central dogma of molecular biology, DNA is converted into mRNA by the process of…
Q: BONUS: In Bacteria, catalyzes formation of peptide bonds during translation (answers must be in…
A: RNA nucleotides are linked together by 3’-5’ phosphodiester linkages. The three min RNA in all the…
Q: An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon,…
A: The central dogma describes the flow of genetic information. It states that genetic information in…
Q: Label the following regions on this tRNA molecule, stating the function of each:
A: This is a tRNA molecule. It has an amino acid arm where the corresponding amino acids bind. It has…
Q: When the anticodon on a tRNA is "ICG, all of the following codons except can pair with this…
A: Some tRNA anticodon loops contain inosine (I) which allows recognition of multiple codons through…
Q: The first nucleotide in mRNA that will be synthesized from DNA below is: 3'-…
A: During the transcription process RNA is produced from the DNA within the nucleus of eukaryotic cells…
Q: Determine the mRNA sequence for the wild type polypeptide by identifying the codons that correspond…
A: Polypeptides are chain of amino acids which is bonded by the peptide bonds. It is coded from the…
Q: Which of these features is found in eukaryotes but not bacteria?a. polygene mRNAs b. introns c. stop…
A: Living organisms are primarily classified as prokaryotes and eukaryotes. Prokaryotic organisms like…
Q: Write the mRNA sequence (5′ to 3′) that would result from transcription of the DNA sequence. (Note:…
A: Deoxyribonucleic acid or DNA is the type of nucleic acid present in the nucleus of the cell. It is…
Q: The gene encoding the E. coli enzyme enolase begins with the sequence ATGTCCAAAATCGTA. What is the…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…
A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…
Q: Indicate the mRNA sequence, coding sense DNA sequence and template DNA sequence that produced the…
A: Though it is easier to decide the sequence of amino acids from a given segment of either DNA (any…
Q: the coding strand of DNA has the same sequence as the mRNA, except that there are U’s in the mRNA…
A: an delete the 'C' at position 52 Explanation: it is the type of frameshift deletion mutation…
Explain why the statement is correct.
A section of the mRNA has a
none, this molecule is not an RNA transcript of DNA
Step by step
Solved in 2 steps
- A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA Codons* (anticodon) tRNA Alanine GCU AGA Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine AAU GAU UGU GAA CAA GGU CAU AUU CUU AAA AUG Isoleucine Leucine Lysine Methionine UUU Phenylalanine Proline CCU UCU Serine ACU UGG Threonine Tryptophan Tyrosine Valine UAU GUA There are 64 codons. Some amino acids have several mRNA codor There is, however, no overlap of codes.
- Refer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codonA small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1. Valine 2. Serine 3. Proline 4. Glycine 5. Arginine 6. Leucine 7. Histidine 8. Cysteine 9. Glutamine The amino acids listed above that are coded by the MRNA codons are , and Record your answer in order from left to right codons.An mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’
- How many different mRNA sequences can encode a polypeptide chain with the amino acid sequence Met-Leu-Arg? (Be sure to include the stop codon.)Consider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping. 1. How many codons are represented in this oligonucleotide? 2. If the second G were changed to a C, what would be the resulting amino acidThe DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'
- MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’