Look at the m-RNA message below: PUT A NUMBER under each of the t-RNA/amino acid complexes to show the correct sequence that they would attach as this message is read. methionine AUGUUCAA ACUG UUU UA MRNA WHAT IS THE AMINO ACID SEQUENCE FOR THE PROTEIN THAT WOULD BE PRODUCED FROM THIS MESSAGE? MATCH THE PARTS IN THE DIAGRAM WITH THE CORRECT LABEL. RIBOSOME Asparagine D. NUCLEUS Methionine G. MESSENGER RNA ANTICODON Fodiln E 10010000nn AMINO ACID CODON TRANSFER RNA

Q: Which enzyme removes a phosphate from the 5' end of the MRNA, leaving two phosphates?

A: mRNA is a messenger RNA, it is a single stranded RNA which carries the genetic sequence of the DNA…

Q: Which amino acids are coded for by the mRNA strand: AUG UCA CGA GGU? methionine, leucine, alanine,…

A: DNA is the genetic material present within the nucleus in the cell. It maintains the heredity of the…

Q: 5. The image below is a mRNA message. Please draw a ribosome translating the message below. Draw the…

A: Solution: the required labelled image is provided in the image attached below:

Q: What does the A site on the ribosome do?     What does the P site on the ribosome do?…

A: The ribosome is a complex molecule made up of ribosomal RNA molecules and proteins that functions as…

Q: If a strand of mRNA is UGC CAU GCC, what is the sequence of amino acids that will be produced?  (use…

A: Proteins or polypeptides are the end products of the gene expression process. They are polymers made…

Q: The sequence below is an mRNA strand that is in the cytoplasm ready to translated by a ribosome. If…

A: Translation is the process of formation of a protein chain from a RNA chain. Translation requires an…

Q: RNA Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 Intron 3 Exon 4

A: Eukaryotic primary transcripts are split. That is, they are composed of coding sequences for…

Q: As the ribosome moves along the mRNA, it is moving from [Select ] The protein grows at the [Select ]…

A: Translation is the process by which the genetic code in mRNA is read to produce a protein. This…

Q: Which of these molecules is responsible for bringing the correct amino acid to the ribosome? acetyl…

A: Translation is the process by which the cells of the body prepare their own proteins in the…

Q: Draw a line representing mRNA that has already been processes (introns removed, cap and tail added).…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: The anticodon of a tRNA is 5' AAU 3' Part A What codon does the tRNA recognize? What amino acid does…

A: Transfer ribonucleic acid or tRNA is a small molecules which helps in translation of mRNA into…

Q: Choose the answer that has these events of protein synthesis in the proper sequence. (Note some…

A: The steps of Protein synthesis are collectively  called translation it involves forming proteins…

Q: The fungus Aspergillus giganteus degrades wood using the ribonuclease a-Sarcin. Of the molecules…

A: The ribonuclease α-Sarcin is used by the fungus Aspergillus giganteus to decompose wood. By…

Q: which of the following is mismatched  a- small RNA catalyic with or without proteins  b- rRNA 80% of…

A: RNA is coded from DNA with the help of RNA polymerase enzyme; the process of RNA synthesis is called…

Q: After the complete ribosome is assembled, what is the first amino-acyl tRNA to enter the ribosome's…

A: In the process of protein synthesis, ribosomes play a crucial role by facilitating the translation…

Q: Write the polypeptide sequence that would be translated from your mRNA sequence.

A: Answer -  The DNA sequence will be -  5' CTATAAGGCGCAAATCCCTGCCAT 3' - Non-coding strand 3'…

Q: Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…

A: Transcription is the process that synthesizes mRNA from DNA. The mRNA strand synthesized through…

Q: Which of the following base pairings are allowed between an anticodon and the 3' base of a codon,…

A: According to wobble hypothesis, the third nucleotide of anticodon is a wobble and can base pair with…

Q: n bacteria the ribosome is positioned next to the start codon by   A the ribosome binding site   B…

A:

Q: Choose the correct function of tRNA. O A, TRNAS are an intermediate stage of RNA processing where…

A: INTRODUCTION tRNA tRNA is transfer RNA molecule that can decode the mRNA and helps in the production…

Q: Draw/Diagram how translation starts at the N-terminus of a protein. Include the ribosome and label…

A: It is the process of the formation of proteins by the process of Translation. The proteins are…

Q: Examine the diagram below. At which times is translation but occurring? Production of a Particular…

A: The translation of the information contained in a mRNA (messenger ribonucleic acid) into an amino…

Q: 1)Which of these molecules is responsible for bringing the correct amino acid to the ribosome? RNA…

A: Translation is the process by which proteins are synthesized using ribosomes. It takes place in the…

Q: A- Anticodon

A: Translation: It is the process of synthesis of protein from the mRNA inside the ribosome. The t-RNA…

Q: A small section of bacterial mRNA has the following nucleotide sequence: GGC UAG GUC UUU The tRNA…

A: The encoding of proteins by the DNA involves two processes: transcription and translation.…

Q: What will be the anticodon of the next tRNA added to the A site of the ribosome?

A: Codons are situated in on mRNA and anticodons are situated on tRNA.

Q: Here is the complete mRNA sequence from a bacterial cell: 5'…

A: In protein synthesis, the process of translation converts the sequence of the mRNA (messenger RNA)…

Q: Here is the complete mRNA sequence from a bacterial cell: 5'…

A: To determine how many tRNAs will bind to the ribosome to make the protein, we need to consider a few…

Q: In picture a (look at picture) a tRNA is already bound to the initiator codon at the start of the…

A: Translation is the process of synthesis of polypeptides (protein)  by combining monomers units…

Q: Which functional site is found in the small subunit of the ribosome? peptidyl transferase centre O…

A: Ribosomes, huge ribonucleoprotein particles with three RNA molecules and more than 50 proteins, are…

Q: A protein has the sequence of amino acids shown below. Construct a mRNA molecule that could code for…

A: Introduction  Amino acids are the organic substances which have amino and carboxylic acid functional…

Q: Consider an image of an mRNA being translated. fMet Pro HAUG COCACG

A: In biology, "translation" refers to the second stage of protein synthesis, which is the process by…

Q: The ribosome catalyzes the formation of peptide bonds. Which of the following statements is false?

A: The ribosome employs entropic catalysis to accelerate peptide-bond formation by positioning…