The S-D (shine-Dalgarno) sequence is part ofO a. 23S rRNA in 50s subunitO b. 6S FRNA in 50S subunitMRNAO d. 16s rRNA in subunit 30S

Name: The S-D (shine-Dalgarno) sequence is part ofO a. 23S rRNA in 50s subu
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The S-D (shine-Dalgarno) sequence is part ofO a. 23S rRNA in 50s subunitO b. 6S FRNA in 50S subunitMRNAO d. 16s rRNA in subunit 30S

Introduction In Bacterial And Archaeal Messenger RNA, The Shine–Dalgarno (SD) Sequence Is A Ribosome…

Answered: The S-D (shine-Dalgarno) sequence is…

Science

Biology

The S-D (shine-Dalgarno) sequence is part of O a. 23S RNA in 50s subunit O b. 6S rRNA in 50S subunit O c. MRNA O d. 16s rRNA in subunit 30S

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 20P

See similar textbooks

Related questions

Q: e? A)A gene's promoter sequence is transcribed into mRNA. B)Translation begins at the 5′ end of a…

A: Transcription is the process of formation of mRNA from the DNA.and Translation is the process of…

Q: The diagram shows part of a pre-mRNA molecule. A G part X (a) (i) Name the two substances that make…

A: Within the cells two types of nucleic acids are found, that are DNA and RNA. They both composed of…

Q: The function of the genetic code is toa. promote transcription.b. specify the amino acids within a…

A: Genetics can be defined as the branch of biology which is concerned with the study of genes, genetic…

Q: What types of changes take place in rRNA processing? a. Methylation of bases b. Cleavage of a larger…

A: Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles in decoding,…

Q: During Codon recognition (a) the ribosome moves towards the 3’ end of the mRNA (b) a tautomeric…

A: A codon is the three-nucleotide stretch of sequence which codes for proteins. In central dogma, it…

Q: Portions of eukaryotic mRNA sequence that are removed during RNA processing are ________. a. exons…

A: The genetic material of a cell or an organism refers to those materials found in the nucleus,…

Q: Which of these molecules would have the most monomers (i.e. be longest)? a) RNA polymer that…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: Each ribosomal subunit is composed of a. multiple proteins. c. tRNA. b. rRNA. d. both a and b.

A: The rRNA or ribosomal RNA is involved in translation. The ribosomal protein along with the rRNA make…

Q: If a strand of mRNA is UGC CAU GCC, what is the sequence of amino acids that will be produced? (use…

A: Proteins or polypeptides are the end products of the gene expression process. They are polymers made…

Q: The anticodons are located in a.tRNA. b.rRNA. c.mRNA. d.ribosomes. e.endoplasmic reticulum.

A: Anticodons- An anticodon is a trinucleotide sequence complementary to that of a corresponding codon…

Q: Considering each nucleotide sequence in an mRNA molecule: [1] write the sequence of the DNA template…

A: Gene expression is the process by which the instruction in the DNA is converted to products through…

Q: Match each statement below with the correct RNA molecule. A. rRNA B. mRNA C. tRNA D. uRNA…

A: mRNA contains the codons in the form of triplet of nucleotides during transcription and is…

Q: The relationship between a gene and messenger RNA is as follows: O A. all genes are made from mRNAs…

A: mRNA are made from genes.

Q: To facilitate movement of mRNA from the nucleus into the cytoplasm, what is added to the 3’ end of…

A: According to the question, we have to explain to facilitate the movement of mRNA from the nucleus…

Q: For translation of eukaryotic mRNA sequences: a) The stop codon stops translation by blocking the…

A: Translation refers to the process of polymerisation of amino acid to form a polypeptide. The order…

Q: The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome:…

Q: A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Complete the table below: DNA DNA Complimentary Strand mRNA sequence tRNA sequence Amino…

A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…

Q: Which of the following statements about mRNA is INCORRECT? A. the sugar moiety of mRNA is D-ribose…

Q: Which form of RNA acts as a blueprint for polypeptide biosynthesis by the ribosome? O a. FRNA O b.…

A: Messenger RNA (mRNA) is a type of RNA that transports the protein blueprint from a cell's DNA to its…

Q: A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: Transcription is the process in which RNA is synthesized from DNA.

Q: A. Below is a DNA sequence. Write the sequence of mRNA codons that would result from the…

A: According to the question, a DNA sequence is given. We have to find out the sequence of mRNA codons.…

Q: The portion of a gene that will be expressed in a protein is called a(an) a. Exon b. Intron c.…

A: A gene is a segment or region of DNA (deoxyribonucleic acid) that encodes for proteins or regulatory…

Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…

A: DNA is a double stranded helical structure present inside the nucleus. It acts as a hereditary…

Q: Among types of functional RNA by them self is: O rRNA .a O mRNA .b O both choices .c O none of…

A: Ribonucleic Acid(RNA) Types of functionally important RNAs are given in the below step.

Q: Bēlöw is thế TEMPLATE strand of DNA for a particular gene. Template strand: 5' AATCАTAAСТСАТTG 3' A.…

A: The two types of strands in DNA are coding (non-template) and template (non-coding). Both strands…

Q: Match the terms with the best description.____ genetic message a. protein-coding…

A: A gene is a specific sequence of nucleotides in DNA or RNA that is usually found on a chromosome and…

Q: Anti-codons are found in (a) rRNA (b) mRNA (c) tRNA (d) DNA (e) proteins

A: The translation is the process of translating the sequence of a messenger RNA (mRNA) molecule to a…

Q: Label the features of a tRNA by dragging the labels to the correct targets. A Binds an amino acid B.…

A: tRNA is also known as transfer RNA which helps in the transfer of amino acid to the mRNA codon…

Q: 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA.…

A: The double-helical structure of DNA was transcribed into mRNA molecules and these mRNA molecules are…

Q: A release factor is referred to as a “molecular mimic” because its structure is similar to a. a…

A: Translation is a process of translating the sequence of messenger RNA molecule to amino acid…

Q: how does the E.coli ribosome find the RNA to be translated? A. the sigma factor B. the shine-…

A: SHINE DALGARNO SEQUENCE The ribosome binds to the ribosomal binding site present on messenger RNA in…

Q: Introns are Poly A tail to RNA Noncoding sections of RNA Ribonucleoproteins Coding sections of RNA

A: Question: Introns are?

Q: In a polyribosome, the polypeptides associated with which ribosomes will be the longest? a. Those at…

A: Ribosomes are involved in translation by building proteins from amino acids using messenger RNA as a…

Q: In elongation, the creation of peptide bonds between amino acids is catalyzed by a. rRNA. b. a…

A: We know that the process of translation involves formation of protein from the mRNA (messenger…

Q: In the image below, what is the C label pointing to?

A: The above image represents transcription where the RNA polymerase move along the DNA and make the…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: DNA is the genetic material in most organisms. It is the information hub of the cell that contains…

Q: The anticodon … A. is complementary to the mRNA B. is found on the ribosome C. is found…

Q: Amino acids bind to which part of the tRNA?a. Anticodonb. DHU armc. 3′ endd. 5′ end

A: t-RNA also termed as transfer RNA is type of RNA which carries a specific amino acid to m-RNA…

Q: Eukaryotic mRNA is capped at the 5' end by:

A: Eukaryotic messenger RNA after synthesis in the nucleus move to the cytoplasm for translating…

Q: Define the following terms: a. chemotaxis b. lac operon c. 80S ribosome d. mRNA secondary structure…

A: Ribosomes can be defined as the minute particles that will consist of RNA and interacted proteins…

Q: . To attach to viral sequences b. To weigh down mRNA c. To terminate translation…

A: The purpose of a Poly-A tail being added to mRNA is to terminate translation. The polyA tail is a…

Q: forms hydrogen bonds with its own bases to form a clover leaf/ key like structure (a) mRNA (b)…

A: Hydrogen bonds are formed between the complementary bases of the nucleotides of the RNA or DNA.…

Q: Match the type of RNA with it's function A. Creates the Ribosome, or work table to pull amino acids…

A: Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles in coding,…

Q: The DNA sequence of a gene is CCATGCT A. The corresponding mRNA produced from 6. this gene is a.…

A: The protein synthesis consumes large amount of a cell’s energy as compared to the other organic…

Q: triplet of bases on an mRNA molecule is known as a(n)

A: A triplet of bases on an mRNA molecule is known as a(n) Answer: c) codon.

Concept explainers

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.

Topic Video

Question

The S-D (shine-Dalgarno) sequence is part of
O a. 23S rRNA in 50s subunit
O b. 6S FRNA in 50S subunit
MRNA
O d. 16s rRNA in subunit 30S

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

41/ 50 An RNA which has a functional group that allows & to act as a catalysts generaly called 50 A SRP B snRNP C. cofactor D ribozyme transcription factor
55__________________ assemble to form a spliceosome, the splicing machine that excises introns. A.snRNAb.tRNAc.Micro RNAD.rRNAs 56Eukaryotic initiator tRNA is charged with a formylated methionine. Yesorno 57Eukaryotic mRNA can be purified by separating molecules a mixture of total RNA by: A.Oligo (dG) cellulose chromatographyb.Oligo (dT) cellulose chromatographyc.Oligo (dC) cellulose chromatographyD.Oligo (dA) cellulose chromatography
After the polypeptide chain is passed to the next amino acid the uncharged tRNA leaves through this site A site E site P site
The peptide bond formation is catalyzed by a. the aminoacyl tRNA synthetase b. tRNA c. the small ribosomal subunit d. the large ribosomal subunit
Which of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a ribosome? Second letter C UGU cys UCU1 UCC UCA UCG UAU Tyr UACS Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUU UGCS Phe UUC U UUA UUG FLeu CAU HiS CGU] CUU CUC Leu CCU ССС CCA CCGJ CACS CGC Arg CGA CAA GIn Pro C CUA CUG J CAG S CGG AUU AUC lle AUA AAU Asn AGU ser ACU АСС Thr ACA AAC AAA ys AGA Arg AAG J AGC AUG Met ACG Lys AGG J GUU GUC CUA Val GAU ASP GCU GACJ GCC FAla GGU] GGC CGA Gly CCA C CAA M UCAG Third letter UCAG UCAG First letter
below is a prokaryotic mRNA transcript and the polypeptide that results as this transcript is translated. Pro Arg CCU CGU CAU 3 c. in the diagram translation is currently in the elongation phase d. the enzyme involved here is RNA polymerase e. codons of the mRNA reading frame are translated in the 3'5' direction in Indicate true (T) or false (F) for each statements below. Only use the letter (T/F) in the space provided a. tRNAArg is bound at the P-site b. The amino acid that will be added next to the chain is His
The anticodon is located in which of the labeled regions of the tRNA shown here? O O a. A b. B C. C d. D C 56 20 54 44 32 64 26 38 12 69 B 72 AA 3'
Small ribosomal sub-unit MRNA Codon Large Ribosomal sub-unit Amino acid Anticodon A B. F Three sites from tRNA are G This process is called H The direction of ribosome scanning is D. "to C E B
A. rRNA is used to transfer amino acids to the ribosome. make up the large ribosomal subunit. make up the subunits of a ribosome. make up the small ribosomal subunit. B. When the full ribosome has bound to mRNA for the first time, the first codon (start codon) of the mRNA is in which site? It varies. P E A
Which tRNA is about to be ejected from the "E" site of this ribosome? A tRNA for Pro tRNA for Ser tRNA for Glu tRNA for Met tRNA for Leu tRNA for Gly U A G Gly Gly A U Pro Met Glu Ser Leu A C Leu & G A U U A U
The tRNA molecule shown above would be found in the Row A B. C. 3. B D. ect one: A. A i nucleus nucleus cytoplasm cytoplasm amino acid attachment site ii leucine i of a cell, and would carry the amino acidii (select the row that asparagine leucine (an amino acid) asparagine UUA anticodon
A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine