**Use the figure of a tRNA to answer the following question:**![tRNA Diagram](#)The diagram shows a tRNA molecule with several labeled regions: A, B, C, D, and E. The structure resembles a cloverleaf with three loops and a linear sequence at one end labeled as CCA. Each labeled region corresponds to specific features of the tRNA molecule:- **A**: The acceptor stem where amino acids attach.- **B**: The D-arm.- **C**: The anticodon loop, which pairs with mRNA codons.- **D**: The TΨC arm.- **E**: The CCA tail consistent in all tRNA molecules where amino acids bind.**Question:** Aminoacyl tRNA adds an amino acid to letter _______ and base pairing with the codon of an mRNA occurs at letter _______.- A and E- B and C- C and E- D and AAnswer the question based on the understanding of tRNA structure and function. The correct options relate to where amino acids are attached and where anticodon-codon interaction occurs.

Use the figure of a tRNA to answer the following question: -E D Aminoacyl TRNA adds an amino acid to letter and base pairing with the codon of an MRNA occurs at letter O A and E O Band C O C and E D and A

Use the figure of a tRNA to answer the following question: -E D Aminoacyl TRNA adds an amino acid to letter and base pairing with the codon of an MRNA occurs at letter O A and E O Band C O C and E D and A

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Use the codon sequence to translate the following mRNA sequence (start with the start codon - AUG - codes for methionine): mRNA sequence - AUGUAUAAGUAA [ Choose ] methionine, lysine, Stop, tyrosine 1st codon 2nd codon 3rd codon 4th codon
DNA gene TAC AGC TTT mRNA codon (No thymine in RNA!) tRNA anticodon (No thymine in RNA!) Amino acid Use the mRNA with the Genetic Code. Use the mRNA with the Genetic Code. Answer the questions below. Questions How many nucleotides would be needed to code for a protein that has 100 amino acids? Using the Genetic Code in Table 6.3, write all of the possible codons that signal the start and end of a gene. Start: End: An amino acid sequence of a protein molecule includes methionine, lysine, serine and glycine. Show each different codon that could result in each of these amino acids. You will have more than one codon for all of them except methionine. Amino Acids All Possible Codons Methionine Lysine Serine (Look carefully. There are six possibilities) Glycine Question 3 illustrates the redundant nature of the genetic code. Can you think of an advantage of having several codons that all code for the…
Which of the following mRNA codons could be changed to a stop codon by a single base pair substitution in DNA ? [In other words, if you substitute one of the bases for a diferent one, it will produce a stop codon. Don't overthink this. Just look at the codon as written, and see if changing any one base leads to a stop codon]. 1. UAC (tyrosine) 2. UGG (tryptophan) 3. CGA (arginine) 4. ACU (threonine) A. 1, 2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1, 2, 3 and 4 are correct
Complete the box below: Convert the following template strand of DNA bases into its complementary mRNA molecule. Next translate the DNA into a polypeptide chain of amino acids using the Table above. CAATATGGAAGCCGACTCACCCTAATT
Below is a diagram of charged TRNAS in the active site of the ribosome during translation of the mRNA into protein. Which amino acid was originally bound to tRNA A from the figure below? X. Ala Arg Cys Gly Met Trp Leu Glu TRNA B TRNA A A TIND O Arg O Leu Glu O Trp
State the direction of movement of the ribosome along the mRNA strand (the direction of translation). 5’ to 3’
5. Below is a segment of RNA, transcribed from a DNA sequence. Use the following codon chart to help answer the questions below. 5' AUG/CCU/ACG/GAC/UGG/CCU 3¹ First Letter U C A The genetic code Second Letter A U с G phenylalanine serine tyrosine cysteine phenylalanine serine tyrosine cysteine leucine serine stop G leucine leucine leucine leucine leucine serine proline isoleucine start/ stop histidine stop tryptophan arginine proline histidine arginine proline glutamine arginine proline glutamine arginine threonine asparagine serine isoleucine isoleucine threonine asparagine serine threonine lysine arginine threonine lysine arginine methionine valine valine valine valine a. What polypeptide would be generated by this sequence? alanine aspartate glycine alanine aspartate glycine alanine glutamate glycine alanine glutamate glycine Third Letter DUAGUUAGUUAG C с А UCAG b. The RNA is mutated to: 5' AUGCCCACGGACUGGCCU 3. What type of mutation has occurred? Show the new polypeptide chain. c.…
Consider an image of an mRNA being translated. Ŝ ACG Aul fMet GGG GCCCACG UG Pro What is the sequence of the anticodon, from the 3' to 5' end, of the tRNA in the A site? UGC AUG UAC What is next amino acid added to the growing polypeptide chain? Use the codon and codon table. Thr Cys O Tyr Met
Which three codons would code for a different amino acid sequence from that coded for by the mRNA base sequence AGU-UCA-CCA? O AGU-UCC-CCG O AGU-UCG-CCC O AGC-UCA-CCU O AGC-UCU-CCU
A mistake during DNA replication leads to a mutation in the nucleotide sequence shown below. DNA DNA ATG CCT TGT GẠC ATG CCT TGA GẠC transcription transcription MRNA MRNA AUG CCU UGU GAC AUG CCU UGA GAC original sequence mutated sequence What kind of mutation will result from the mistake made during DNA replication in the nucleotide sequence above? O A. Silent Mutation B. Chromo C. Nonsense Mutation D. Frameshift Mutation
A Section of a Gene TGC GTG TAC CTA CCA For the DNA sequence shown above, identify the following: mRNA codons tRNA anticodons amino acids
Which of the following anticodons of a tRNA molecule can base pair with three different codons on an mRNA molecule? What is the correct answer from the choices below? AUU CCG IAU UAG GCG