A mistake during DNA replication leads to a mutation in the nucleotide sequence shown below. DNA DNA ATG CCT TGT GAC| ATG CCT TGA GAC| | transcription transcription MRNA MRNA AUG CCU UGU GẠC AUG CCU UGA GAC original sequence mutated sequence What kind of mutation will result from the mistake made during DNA replication in the nucleotide sequence above? O A. Silent Mutation O B. Chromo O C. Nonsense Mutation O D. Frameshift Mutation

Q: In problem 2e, how can you identify added mutations?

A: Mutations are changes in the base pairs of DNA that are heritable to the offspring. Mutations caused…

Q: During transcription the strands of DNA unwind due to the action of

A: Transcription and replication are processes that need access to DNA. DNA is usually tightly coiled…

Q: What is the mRNA coded by this template DNA strand? DNA Template Strand: 3' ATGGTACGGTCG 5' O5'…

A: Transcription Through the process of transcription, the sequence of DNA gets transformed into the…

Q: A section of DNA has the base sequence shown in #1. A mutation in this DNA strand results in the…

A: The mutation is the change in the nucleotide sequence of the DNA. There are several types of…

Q: Which of these are a DNA sequence are which are a protein? Column A Column B 1. A gene's promoter a.…

A: RNA polymerase - Enzyme used to convert DNA into mRNA. Introns - non-coding part of the gene. Exon -…

Q: 8. Which serves as the template for the assembly of amino acids during protein synthesis? * A. DNA…

A: As per our guideline, I gave you the first 3 answer below. Please post rest of the question…

Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…

A: transcription is the process by which messenger rna is made from dna .

Q: What kind of mutation is present in the following DNA strand?: Wild-type: 3'-AGTCCCTGAAAT-5'…

A: b. MISSENSE MUTATION

Q: . The table opposite shows the standard (coding strand) DNA inlet codes for the 20 amino acids…

A: Given , the  coding strand is     5'-CATCCAAATTGTTGCCCG-3' THE TEMPLATE STRAND WILL BE ,…

Q: REPLICATION TRANSCRIPTION TRANSLATION Molecule or enzyme a) DNA Polymerase a) Ribosomes b) RNA…

A: Replication- DNA replication requires other enzymes in addition to DNA polymerase, including DNA…

Q: How is synthesis terminated in DNA Replication?   a. DNA Polymerase runs out of template   b.…

A: DNA replication is divided into three steps initiation, elongation and termination. In order to…

Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: According to Bartleby guidelines only the first question in case of multiple questions have to be…

Q: The strand of DNA contains the sequence of bases: CGA CCG TAC. What is the sequence of the…

A:

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Introduction Transcription is a process by which mRNA is produce from DNA. Once the mRNA is formed…

Q: A nucleotide sequence in a segment of a DNA information strand is given here. Sketch (A) the…

A:

Q: For each DNA segment: [1] What is the sequence of the mRNA molecule synthesized from each DNA…

A: Gene expression is the process by which the instructions in the DNA is converted into a functional…

Q: 1. Determine what amino acid will be formed from the given  DNA strand below:…

A: DNA strands are coiled with each other and form the DNA double helix. Each strand of DNA contains…

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…

A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…

Q: onsider the following segment of DNA, which is part of a linear chromosome: LEFT…

A: Answer.  Transcription is a process of the formation of transcript (RNA). It takes place by the…

Q: DNA strand with the sequence 3’ AACGTAACG 5’ is transcribed. What is the sequence of the mRNA

A: Messenger RNA (mRNA) is a single-stranded RNA molecule that is complementary to one of the DNA…

Q: ntify the type of mutation and how it would affect the protein made (amino acid) if the following…

A: DNA is what is inside the nucleus of mostly all cells. It carries the genetic information which is…

Q: f an error is made during replication that is not caught by DNA polymerase, the most likely is that…

A: DNA polymerase is an enzyme which catalyses the synthesis of daughter DNA strand from the parent DNA…

Q: Directions: 1. Use the DNA code to make a replicated copy of DNA. 2. Use the replicated DNA code to…

A: Replication : it is the process where DNA duplicates Transcription: the process of making an RNA…

Q: 6.d. Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’ Complementary DNA sequence:…

A: Replication is the process of formation of identical copies of DNA. It occurs in nucleus.…

Q: Give

A: Introduction:- The central dogma of biological sciences explains how genetic information is…

Q: 1. What is called the functional unit of a DNA molecule that may code for RNA or protein? A. arnino…

A: DNA or deoxyribonucleic acid is the molecule that is made up of polynucleotide chains coiled around…

Q: As a general rule, the first codon on a the DNA template strand thatsignals the start for a protein…

A: A codon is a trinucleotide sequence of DNA ( Deoxyribonucleic acid) or mRNA (messenger RNA) that…

Q: The bacterial repair system that corrects mismatched bases after polymerization is able to…

A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…

Q: . The table opposite shows the standard (coding strand) DNA riplet codes for the 20 amino acids…

A: Introduction The process of synthesis of proteins occurs in two steps which are transcription and…

Q: A frameshift mutation occurs in a DNA strand. The mutation is a deletion of the two nucleotides…

A: A frameshift mutation is a genetic mutation caused by a deletion or insertion in a DNA sequence that…

Q: DNA TRANSCRIPTION TRANSLATION REPLICATION (D) DNA template (B] 3'-5' (C) MRNA (E) New (F) Name of…

A: Transcription is the process of synthesizing an RNA by the action of a DNA dependent RNA Polymerase.…

Q: One of the mechanisms that leads to the DNA mutations is a process known as DNA polymerase slippage…

A: DNA slippage is a type of DNA strand misfiring mechanism that occurs in the repeated nitrogenous…

Q: The template strand of a gene contains the following sequence: 3'-TAC TTG TCC GAT ATC-5' Following a…

A: Introduction A mutation is a change in the sequence of nucleotides in DNA or RNA. Everyone is…

Q: The coding DNA strand of a gene has the following DNA sequence:  5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’…

A: Answer: Central Dogma : It is the complete procedure of replication , transcription and translation…

Q: Figure 1 shows a DNA base sequence. It also shows the effect of two mutations on this base sequence.…

A: Given DNA bases:  A T T G G C G T G T C T   The amino acids of the DNA triplets are also given.

Q: All transposons would have these components among A- D EXC A) O transposase B) O insertion sequences…

A: Transposable elements are those DNA sequences that move from one location on the genome to…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Given DNA strand:  5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'

Q: In the cell, DNA polymerase I replaces nucleotides O a. to the 5' end of the RNA primers of the…

A: DNA replication is a complex process in which the two strands of DNA double helix are separated, and…

Q: What is the effect of the insertion of a nucleotide in the 4th codon of the DNA sequence below?…

A: There are two strands of DNA :- template and coding strand . Template strand read in 3' to 5'…

Q: Which of the following statements are NOT true?   A. Replication is the process of making DNA and…

A: During protein synthesis, translation is the method of transforming the sequence of a messenger RNA…

Q: During replication, three nucleotides accidentally were inserted in the middle of a gene, all right…

A: Mutation is defined as the change in sequence of nucleotide in a gene.

Q: TRANSCRIPTION a) polypeptide TRANSLATION a) MRNA b) both strands of DNA c) TRNA d) one strand of DNA…

A: For replication, we require both strand of DNA that will act as template stand for bi-directional…

Q: anslation is synthesis of proteins from: t-RNA A. B. C. D. m-RNA r-RNA DNA 41. It is a type of…

A: *We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: radiodurans can survive strong ionizing radiation (gamma radiation). What DNA repair process? a.…

A: Gamma radiation break DNA strand and create oxidative DNA damage.  To repair this need homologous…

Q: If the DNA has a triplet code of CAG in one strand (the strand used as a template for transcription)…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: Mutation occurs in which part of the central dogma process? a. replication b. transcription c.…

A: Mutation is a sudden change or alteration in the sequence of DNA that might or might not produce an…

Q: One strand of DNA has the base sequence as shown below. Complete the transcription and translation…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Here is a DNA template strand’s sequence and direction: 3’-TACGCGGTAATC-5’ . What is the sequence…

A: The deoxyribonucleic acid (DNA) undergoes the process of transcription for synthesizing the…

Q: At the DNA level, a mutation in a protein coding region where a single base is replaced by another…

A: Mutation is the abrupt change that occurs in the sequence of DNA resulting In altered phenotype.…

Q: The following is a part of the sequence on DNA template strand. 5' ATGGCCCGGTAAGTA 3' Write the…

A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA that codes for a specific…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.