8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the MRNA. Write the corresponding mRNA 5' 3' and translate this mRNA into protein. DNA 3' СCGTGAATАCGCTACGGAАСТСАСТGGTА 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' MRNA 5' Protein Alanine Tyrosine A Stop Valine GU Cysteine G Stop Tryptophan Arginine G AC U Serine Leucine Lysine Proline Asparagine GACUGACU Serine opusol Histidine Threonine

Q: DNA MANNMANN B mRNA Transcription Transport to cytoplasm for protein synthesis (translation) Mature…

A: Introduction :- Protein synthesis is the process of creating proteins from amino acids inside live…

Q: What would be the 5 first nucleotides that form the mRNA?

A: Transcription is an important step in the gene expression in eukaryotes and Prokaryotes. It involves…

Q: The sequence below represents the template strand of DNA of the first two exons (out of 5) of a…

A: DNA is the hereditary material present in most of the eukaryotic organisms.The full form of DNA is…

Q: 16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid…

A: The genetic code is a set of rules used by living cells to translate information encoded in genetic…

Q: Identify the parts of a gene/transcription unit and identify the parts that are transcribed. The…

A: DNA is the nucleic acid that behaves as a carrier of genetic information in almost all biological…

Q: 3. Transcribe the following DNA sequences into their corresponding mRNA. (Hint: be sure to pay…

A: Transcription One of the initial steps in gene expression is this procedure. The transport of…

Q: 1. corrected DNA sequences 2.mRNA sequence 3. Amino acid sequence and description 4. Drawing of…

A: The gene is the sequence of DNA which carry information to code for a specific protein or functional…

Q: DNA sense or template DNA sense or template mRNA tRNA protein 5', 3' amino or carboxyl 5' T A U A R…

A: DNA -> Transcription -> mRNA -> Translation -> ProteinTranscription is the synthesis of…

Q: 2. Given a DNA template molecule of 5'- ATGGCTCCTACCTACTAGTTAACATATGG-3', generate the mRNA sequence…

A: We are given a sequence of DNA in 5'-3' direction.  We have to generate the mRNA sequence and then a…

Q: Which process is illustrated in the diagram? Pre-mRNA Exon 1 Lariat Exon 1 BEIN Intron Step 1 Step 2…

A: mRNA splicing is a process by which a newly made precursor messenger (m) RNA transcript is…

Q: 1. For each of the sequences, place an X in the box to indicate the process most immediately…

A: Note: According to the guidelines, we are supposed to answer only one question. Please repost other…

Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…

A: transcription is the process by which messenger rna is made from dna .

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…

A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…

Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling…

A: Template Strand:The template strand is indeed the DNA strand that serves as a template during…

Q: Transcribe the given DNA sequences to mRNA. DNA: 5'-CGCCTAG-3' mRNA: 3'- DNA: 5'-AATGCGATT-3' mRNA:…

A: Both DNA and mRNA are nucleic acids that are required for gene expression and protein synthesis. DNA…

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: When you are extracting DNA one of the first steps is to dissolve the cell membranes with ice cold…

A: Gene expression: The process in which genetic information encoded in genes is expressed in the form…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: Name (Last, First): DNA An RNA Polymerase attaches to the DNA and transcribes the DNA to mRNA…

A: Introduction  Gene expression is the process through which a gene's information is used to create a…

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: 6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3'-TACT…

A: Wild type sequence:                           3' TACTGACTGACGATC 5' Complementary : 5'…

Q: 8. The following diagram illustrates a step in the process of translation. fMet Pro mRNA UAC GGG…

A: To identify the locations within the ribosome during protein synthesis (translation) corresponding…

Q: The sequence of mRNA made using the DNA double helix shown below is (Select ] The sequence of…

A: Introduction Protein synthesis is a two step process. In the first step, a molecule of mRNA is…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: Identify the parts of a mature mRNA Which of the following is found in the mature mRNA but not in…

A: mRNA It refers to the messenger ribonucleic acid which is single stranded RNA that is read by the…

Q: A. How long will the coding region of the processed mRNA transcript be? (Remember that stop codons…

A: A. In an mRNA exons refer to the coding region while introns refer to the non-coding regions. During…

Q: 63 62 GI GS G4 GGU AUG GCC AUG CUC ACG GAG UAC CGG R (the strane CUC GAG AAG The original template…

A: the process shown in the picture above is is protein translation where protein is translated…

Q: 1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that…

A: The amino acids in the given sequence are leucine, tyrosine, glycine, glycine, and valine.

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Identify the parts of a matur mich of the following is found in nucleotides 5 can

A: mRNA or messenger RNA are polynucleotide molecules having backbone of ribose sugar and phosphate.…

Q: 2ith the diagram provided please write the polypeptide. sequence obtained from the translation of…

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: 1. Create a DNA sequence with eighteen nucleotides. Indicate its 3’ on the left and 5’ on the right…

A: Three parts are solved in case of interlinked question as per our company policy. If you want…

Q: a. What polypeptide is coded for by the mRNA sequence: 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'? N-terminus -…

A: A sequence of three consecutive nucleotides in messenger RNA (mRNA) coding for amino acids is…

Q: 16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid…

A: DNA is a self replicating molecule. The process by which mRNA is produced from DNA is called…