2ith the diagram provided please write the polypeptide. sequence obtained from the translation of the black allele gene

Q: please answer the question provided in the picture about the black allele gene asap please

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: Give 3 different tRNA anticodon sequences that could be mutated by a single base substitution into…

A: In transcription, mRNA takes the message from DNA to the cytoplasm for translation into proteins…

Q: the mRNA and DNA used to synthesize the polypeptide sequence shown and the nucleotides of the tRNA…

A: DNA has two strands. One is called template strand and other is called coding strand. These two…

Q: Which statement is FALSE? Group of answer choices   Histones are very conserved at the primary…

A: 2nd statementis false. H1 doesn't contain histone fold domain. H2A, H2B, H3 and H4 have HFD

Q: . The human gene for ß2 lens crystallin has the components listed below. The numbers represent…

A: Since we only answer up to 3 sub-parts, we’ll answer the first three. Please resubmit the question…

Q: Part A The bacterial gene little protein (lilP) makes a small protein of 11 animo acids (AA) in…

A: Introduction :  The translated form of the DNA sequence is the amino acid sequence. The DNA sequence…

Q: None

A: a) The informational strand (also known as the coding strand) of DNA is complementary to the…

Q: 28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it…

A: Transfer RNA (tRNA) molecules contain a sequence of three nucleotides known as the anticodon. It is…

Q: 9. (2) Here is a sequence of double stranded DNA. Choose a pair of primers to amplify gene X.…

A: Polymerase Chain reaction or PCR is a rapid in vitro technique for amplifying target DNA…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: 5’ GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG 3'  From above sequence…

Q: What is the length in basepairs of these sequences? How many base substitutions are there between…

A: The multiple sequence alignment (MSA) involves the alignment of three or greater than three…

Q: For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'

A: Polymerase chain reaction (PCR) is a technique to amplify the sequence of DNA. A large quantity of…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you…

A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…

Q: In Figure 1-8b, can you tell if the number of hydrogenbonds between adenine and thymine is the same…

A: DNA (Deoxyribonucleic acid ) the building blocks of DNA are the Nucleotides Nucleotides are made up…

Q: For the anticodon sequences  5' IAA, consider the DNA sequence of the gene encoding the tRNA, what…

A: Transfer RNA is a RNA which is used in the protein synthesis or translation process. It carries a…

Q: C a 3' 5' exon intron exon intron exon intron untranslated region (UTR) coding sequence (CDS) Label…

A: Genes are the hereditary unit of an organism. It is inherited by the progeny from the parental…

Q: Based on the alignment of these protein sequences below, which [pairs] of the genes appear to be…

A: Based on the alignment of the protein sequences provided in the image, it appears that: SEQUENCE 2…

Q: Please find the attached file.

A: Ames test is used to test for a mutation causing the ability of a chemical in the DNA…

Q: 1. What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. 2. Write out the…

A: Introduction  DNA (Deoxyribonucleic acid) sequence is the order of nucleotide bases (adenine,…

Q: What is the mRNA transcribed from the "anti-sense" strand of this DNA shown below? 5' TATGGC 3'.…

A: Given: Messenger RNA (mRNA), a molecule in cells that carry codes from DNA in the nucleus to areas…

Q: Which of the following sequences would pair best with this sequence: 5'-CGATTCGA-3' O 5'-UCGAAUCG-3'…

A: In DNA, the nitrogenous bases adenine (A) pairs with thymine (T), and cytosine (C) pairs with…

Q: 5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to…

A: Some enzymes are called endonucleases cleave the phosphodiester bonds that exist in the DNA. Some…

Q: THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes…

A: Note: You have asked multiple sub part questions but as per our instructions we are instructed to…

Q: uestion 12 of 30 > Attempt 2 5'-GGU-3',5'-AAG-3',5'-IAC-3',5'-UGU-3', and 5'-CAA-3'. Give all A…

A: Step 1:The small RNA molecule transfer RNA (tRNA) is required for protein synthesis. Transfer RNA…