THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes for first eight amino acids of the ß chain of hemoglobin. The ß chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA?

Q: Vhich type of mutation occurs when a DNA sequence changes from GGA TCA CCG GAA... to GGA TCG CCG…

A: Step 1: A mutation is a change in our DNA sequence that occurs as a result of errors during DNA…

Q: What monomer gets added into DNA? Deoxyribonucleoside pentosephosphate  Nucleotide triphosphate…

A: Nucleotides are the building blocks of DNA and RNA. DNA contains deoxyribose sugar while RNA…

Q: 1. corrected DNA sequences 2.mRNA sequence 3. Amino acid sequence and description 4. Drawing of…

A: The gene is the sequence of DNA which carry information to code for a specific protein or functional…

Q: 16/ The phosphates that make up the phosphodiester bonds in DNA have pKa  2. What is the sign of…

A: pKa of the phosphodiester bond in DNA = 2 It is desired to calculate the charge on DNA at neutral…

Q: In ONE sentence define the function of the following 1. SSBS = The SSBS are single 2. Beta subunit…

A: These are all the enzymes used in replication of DNA Replication of DNA is a very important process…

Q: True or False, if the statement is false, provide the correct answer. 1. The amino acid sequence is…

A: Introduction Photosynthesis is the process by which plants transform CO2 absorbed from the…

Q: Identify the reasons why the DNA molecule you selected would lead to DNA synthesis. It is…

A: An important characteristic of DNA replication is that it is semiconservative. Two strands of DNA…

Q: If a SNP is found much more frequently in dogs with white fur than in dogs with black fur, the SNP…

A: Single nucleotide polymorphisms (SNPs) in GWAS are essential for understanding the genetic…

Q: 6 of 11 The sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design…

A: The PCR or polymerase chain reaction is a technique in which a particular DNA sequence is amplified…

Q: Sickle cell anemia occurs due to a point mutation in a gene for hemoglobin protein. This mutation…

A: Sickle cell anemia occurs due to point mutation in a gene for hemoglobin. Its symptoms are - fatigue…

Q: | ampicillin resistance gene 5 restriction site 6 Origin of replication 7 Ligase 2 promoter 3 Xhol Ч…

A: Ans:-       Exon    is a region of DNA that is not transcribed. Restriction site is the location in…

Q: d). It's the temperature at which the mass of single stranded DNA equals the mass of double stranded…

A: Option d is NOT a correct description of the DNA melting temperature for a system in which we have…

Q: 5. Patients with palmoplantar keratoderma (PPK) have yellowish thickening of the skin on their hands…

A: Introduction :- A pedigree is a genetic representation of the inheritance of a trait or disease…

Q: Review concepts 21.5-21.6. Match term and its description. the mechanism contributes to polyploidy |…

A: Chromosomal aberrations are changes in structure or number of chromosomes. These include gain or…

Q: Kree DNA has histone like proteins that wrap up in nucleosomes. The Kree have a core DNA length of…

A: Nucleosomes are the basic repeating unit of 'beads on a string' structure of eukaryotic chromosome.…

Q: What is the subject of the figure: What is the main message of the figure? Give a concise, complete…

A: Mutation is alteration in nucleic acid sequence of the gene which causes altered expression or up or…

Q: The structure of a typical pUC19/human DNA recombinant clone. Ensure that you clearly indicate the…

A: Plasmid vectors are circular and extra chromosomal DNA which are capable of self-replication.…

Q: number 7 and 7a

A: If the given plasmid is digested with the restriction enzymes HindIII, ApaI, PvuI, and PvuII then…

Q: EcoRI Sacl Kpnl Aval ampR Xmal Smal lacZ BamHI Xbal Sall Accl HinclI Pstl Sphl HindIII Bam H1 Bam H1…

A: Answer :- Option (C) is correct. - 1. :-

Q: Question 2. You want your recombinant Human Growth Hormone to be tagged at the N-terminus with a…

A: Cloning is a process of making copies of the a segment such that they are exactly similar to the…

Q: What was the Mendel’s definition of a gene? How was it different from the definition by Beadle and…

A: Please note that keeping with regulations the first 3 questions (actually 5) are answered below,…

Q: prateins OP (weak bonds) a better source of energy than H,O (strong bonds)? 37. What is the…

A: Since you have asked multiple questions, we will solve the first complete question for you. If you…

Q: Question: Which of these statements is TRUE if there is 40% Guanine in a strand of DNA? O There is…

A: Calculation of percentage of bases in a DNA According to chargaff's rule, the concentration of…

Q: DNA ladder 1 DNA ladder 2 bp ng/Sul 10000 8000 40 40 6000 3000 40 4000 40 700 600 3000 40 500 -2000…

A: Agarose gel electrophoresis is used to separate DNA molecules.

Q: sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers…

A: The polymerase chain reaction (PCR) is a laboratory (in vitro) technique for generating large…

Q: 5

A: Recombinant forms of Oestrogen and Progesterone are used in post menopausal women. Recombinant…

Q: Adds nucleotides in in the 5' to 3' direction during transcription. [Select ] [ Select ] ligase…

A: RNA polymerase

Q: Check the new protein created by your new DNA. Describe how this changed the protein (amino acid…

A: Any change in the DNA is called mutation. Some Mutations are beneficial because they add on the…

Q: Explain Corrected Statement Briefly explain: Why the original statement was incorrect How your…

A: Mutation : It is a sudden heritable change , individual that showing these changes are termed as…

Q: True or False: When transcribing the missense strand the direction of growth is towards the…

A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…

Q: 3. Primer Design You are analyzing the

A: Primer is a short stretch of oligonucleotide which is designed to copy the gene sequence of interest…

Q: Continuing from the question above. You are able to correctly modify the blood stem cells and return…

A: Sickle cell anemia is majorly due to missense mutation which results in valine substitution in place…

Q: Instructions: Provide brief answers to the following questions: 1. How many codons are there in the…

A: Note: As Per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A…

Q: 1 4 6 7 8. 9. Transcriptional stop sequence ТАTA box ATG TAA AUG UAA Here is a diagram of a human…

A: The process of transcription catalyzed by RNA Polymerase II in eukaryotes gives rise to the pre-m…

Q: number 5 and 5a

A: A restriction map is a map of unknown sites within a sequence of DNA and requires the use of…

Q: Can you please answer number 28 and 29

A: Any alteration in the genome’s nucleotide sequence is called a mutation. Any agent that results in a…

Q: D Question 38 Consider one of the genes found on the Sars-Cov-2 genetic material. This one gene can…

A: SARS-CoV-2 is a betacoronavirus that was first identified in Wuhan, China in 2019. It is the virus…

Q: The alternating sugar-phosphate backbone of the DNA is hydrophobic    Select one: True False

A: DNA or Deoxy-ribonucleic acid is a complex molecule which contains the genetic code of a living…

Q: Which of these sequences has dyad symmetry? O 5' AATGCTTATCGTAA 3' O More than one of the above O 5'…

A: Dyad symmetry refers to two areas of a DNA strand whose base pair sequences are invertead repeats of…

Q: The anticodon sequence created from the following DNA: TACGGGGCTGAGATT Select one: O a.…

A: The sequence of nucleotides that complement codons is known as an anticodon. They are found in tRNAs…

Q: 2ith the diagram provided please write the polypeptide. sequence obtained from the translation of…

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: double-stranded DNA is dissociated into

A: All organisms must replicate their DNA when cells divide. During DNA replication, an enzyme called…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.