6 of 11 The sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers to amplify the sequence that is in bold and underlined. (Select the binding sites of your chosen primers within the underlined region rather than in the flanking sequence.) 5'-CAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGG TG ATGTGGTGGC TATTGATTATAAACAC TACACACCCTCTTTTAAGAAAGGAGC TAAATTGTTACATAAACC-3 What is the 5' to 3' sequence of the reverse primer? O 5'-TTC GTC CAA AGA ATA TTC-3' O 5'-CAA TAT TCT TTG GẠC GAA-3 O 5'-GTT AAA TCG AGG AAA GAA-3' O 5'-GTT ATA AGA AAC CTG CTT-3' O 5--CAA TTT AGC TCC TTT CTT-3'

Q: scientist is interested in the amplification of a specific DNA fragment in a large plasmid of about…

A: The specific DNA sequence can be amplified by using primers in the polymerase chain reaction or PCR.…

Q: For this activity you will draw out the first steps of the PCR reaction, using the following as a…

A: Introduction  PCR is the revolutionized technique invented by Karry Mullis in 1983, for which he got…

Q: Design PCR primers for the DNA sequence given below and explain your choice. As part of your answer,…

A: It is a Polymerase Chain Reaction, which is a mechanism for multiplying a specific piece of DNA…

Q: You were going to sequence a rice DNA fragment whose sequence was only know at one end, as shown…

A: A primer is a brief sequence of single-stranded DNA that is utilized in the PCR method of polymerase…

Q: You design primers that will amplify a 400 bp fragment of the CAT gene and perform PCR. The 400 bp…

A: PCR is a technique that helps in the amplification of a target gene or a specific region of DNA. The…

Q: 2) The partial coding sequence of the Spike protein for SARS- COV-2 is shown below: You are tasked…

A: The answer is option A  In the PCR amplification, two primers are used to flank the target region to…

Q: In a typical microbiology laboratory, reasons for no bands from a gel of a polymerase chain reaction…

A: Polymerase chain reaction (PCR) is the in-vitro amplification of the DNA sequences. The process…

Q: The sequence at one end of one strand of the Drosophilatransposon Mariner is shown below (dots…

A: The genes are the sequence of nucleotides that are present on the chromosomes and encode for a…

Q: How would I solve this? primer (5’ TCAAAACG 3’ ) is shown hybridized to its template DNA below.…

A: The question inquires about the Sanger sequencing method, a strategy utilized to decide the grouping…

Q: 1. Epigenetic marks refer to modifications to DNA and proteins that in tum regulate gene expression.…

A: Different macromolecules are present in humans. They include carbohydrates, lipids, proteins, and…

Q: Although DNA polymerases require both a template and a primer, the following single-stranded…

A: DNA polymerases require both a template and a primer to synthesize DNA. However, some…

Q: The short sequence shown below is part of a gene of interest. You decide to amplify this part of the…

A: In PCR, primers serve as the initial building block for DNA synthesis. DNA synthesis is carried out…

Q: A team of scientist is interested in the amplification of a specific DNA fragment in a large plasmid…

A: The specific DNA sequence can be amplified by using primers in the polymerase chain reaction or PCR.…

Q: 18. You want to express hemoglobin beta (HBB) in a bacteria model using a vector. You would like to…

A: PCR (Polymerase Chain Reaction) is a laboratory technique used to amplify specific regions of DNA.…

Q: 1a) E. coli DNA and binturong DNA are both 50% G-C. If you randomly shear E. coli DNA into 1000 bp…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…

Q: Below is a portion of an exon from a gene that encodes protein Y in the genome of the plant…

A: Ans 1 :  Yes, there is a mutation in third codon when counting from 5/ to 3/ on template strand in…

Q: Select two primers from the list below such that your selected primers create a pair capable of…

A: Primer is a short strand of nucleotide sequence which helps in synthesis of DNA. After the…

Q: Hindl EcoRI ECORV BamHI 373 Salt Pstl. tet amp Plasmid 1000 DBR322 4361 be ori Ndel you were going…

A: Restriction enzymes or restriction endonucleases/exonucleases are enzymes capable of recognizing a…

Q: sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers…

A: The polymerase chain reaction (PCR) is a laboratory (in vitro) technique for generating large…

Q: How would you write out the sequence for the REVERSE primer if you needed to purchase it for use in…

A: The reason we write the reverse primer sequence in the reverse complement form is to ensure that it…

Q: A 13-nucleotide section of an autoradiogram from a Sanger sequencing experiment is depicted in the…

A: The DNA is made up of nucleotides that contain nitrogenous bases, pentose sugar and phosphate group.…

Q: DNA Polymerase Holoenzyme Il is represented below. It consists of several domains with distinct…

A: At the replication fork, DNA polymerase III holoenzyme (Pol III HE) works with the helicase and…

Q: Below is another template DNA sequence, and you want to use PCR to amplify the region in bold. What…

A: PCR is polymerase Chain Reaction, a technique used in biotechnology  to amplify the selected DNA…

Q: Following PCR amplification of a disease gene, you perform sequence analysis using a primer 20…

A: After performing sequencing through gel electrophoresis DNA fragments are organized according to…

Q: 1) The DNA fragment shown in Figure 1 is cleaved by the restriction enzyme EcoRI as indicated. The…

A: Q 1.) :- Answer.Based on the given information, the DNA fragment shown in Figure 1 is cleaved by the…

Q: Suppose you have to design two PCR primers, 16 bases in length, to amplify the whole of the 100 bp…

A: Primers are short nucleic acid molecule, that are single stranded in nature and area prerequisite…

Q: 5'-GATTACAATAGGAATTC~~ GAATTCTCGTGACTCCG-3' 3'-CTAATGTTATCCTTAAG~ CTTAAGAGCACTGAGGC-5' Which of the…

A: PCR or polymerase chain reaction is a DNA amplifying technique where a short piece of a gene or a…

Q: Which of the following will lead to DNA cutting more frequently? Choose all that apply.

A: The restriction enzymes are enzymes that cut the DNA at specific nucleotide sequences called the…

Q: How many base substitutions are there between these sequences? Count ONLY the instances where there…

A: Sequence alignment involves the comparison of sequences of a particular gene from various organisms…

Q: The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product…

A: Agarose gel electrophoresis used to separate DNA according to its molecular weight. On agarose gel,…

Q: Procedure Restriction maps for Lambda DNA Lambda DNA may exist as a linear or circular molecule. The…

A: The restriction enzyme is the restriction endonuclease which recognises and cut at the specific…

Q: 3a)ClustalX software was used to perform multiple sequence alignment of the following five Nco…

A: Some frequently performed analysis via bioinformatics are DNA sequence analysis, amino acid…

Q: Shown below are several next-generation sequencing reads from a sample you have. Which of the…

A: Genomic research has been revolutionised by next-generation sequencing (NGS), commonly referred to…

Q: DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl…

A: DNA polymerase is a main enzyme for DNA replication.. The two main requirements for working of  DNA…

Q: For your PCR reaction above, the primer set has a much higher AT (low GC) content than what wo be…

A: The content you provided discusses the concept of annealing temperature in the context of Polymerase…

Q: Design primers for PCR that would be able to amplify this entire DNA fragment.  -Design the primers…

A: AThe primer sequence is as follows: FORWARD PRIMER: 5' GCTCAGG 3' REVERSE PRIMER: 5'TCTATTA3'

Q: Bacteriophage T4 has a linear double-stranded DNA genome, yet mapping many mutations, as shown in…

A: T4 bacteriophage infects E.coli. It has a double stranded linear DNA genome. It undergoes a lytic…

Q: Select two primers from the list below such that your selected primers create a pair capable of…

A: Primer is a short strand of nucleotide sequence which helps in synthesis of DNA. After the…

Q: A possible forward primer to be designed is a primer that binds to the region of the OXA-M290 gene…

A: Cloning is a fundamental technique in molecular biology that involves inserting a gene of interest…

Q: 19. You run a PCR of the above HBB sequence using the primers you designed. You receive a vector…

A: i) Gel Electrophoresis Bands:- The ladder serves as a reference for the sizes of the DNA fragments.-…

Q: A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid…

A: Plasmids are small, circular, double stranded, and extrachromosomal bacterial DNA. i.e. it is…

Q: a) Figure 7 shows a sticky end that is cut by restriction enzyme. AAGCTT ATCGAA Enzyme K 3' Sticky…

A: Restrictions digestion is a process where restrictions enzyme cut a specific sites of DNA. The…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.