For this activity you will draw out the first steps of the PCR reaction, using the following as a short template. Take a picture of your drawing and upload it to this Question. 5' TTGCGTACGTGCATGTGTGCACATATGTCC 3' 3' AACGCATGCACGTACACACGTGTATACAGG 5° In your upload submission be sure to include: 1. Label the 5' and 3' end of the template and each primer, and indicate the direction in which polymerization will take place. 2. Write the sequence of a 10 base pair Forward primer and a 10 base pair Reverse primer binding to the template strand. Add an arrow showing which direction polymerization will take place 3. Add a DNA polymerase to the drawing above showing where the polymerase will bind. 3. Draw and label a DNTP nucleotide. Show how this monomer gets incorporated into a new DNA strand?

For this activity you will draw out the first steps of the PCR reaction, using the following as a short template. Take a picture of your drawing and upload it to this Question. 5' TTGCGTACGTGCATGTGTGCACATATGTCC 3' 3' AACGCATGCACGTACACACGTGTATACAGG 5° In your upload submission be sure to include: 1. Label the 5' and 3' end of the template and each primer, and indicate the direction in which polymerization will take place. 2. Write the sequence of a 10 base pair Forward primer and a 10 base pair Reverse primer binding to the template strand. Add an arrow showing which direction polymerization will take place 3. Add a DNA polymerase to the drawing above showing where the polymerase will bind. 3. Draw and label a DNTP nucleotide. Show how this monomer gets incorporated into a new DNA strand?

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

5' 3' O 60°C 5' O 95°C Primer 1 O 75°C ORF For your PCR reaction above, the primer set has a much higher AT (low GC) content than what would be considered normal. Due to this difference in AT content, the optimal annealing temperature for the primers is going to have to be altered from the "normal" temperature cycle: 95°C 60°C ⇒ 75°C Which of the temperatures will have to be altered to accommodate this difference the primer set? Primer 25¹ 3' 5' annealing with
Design primers for PCR that would be able to amplify this entire DNA fragment. -Design the primers so that they are each 7 bases in length. - Indicate the direction (polarity) of both ends of each primer. -Describe where the primer would bind.
Please help I am stuck, I have provided everything needed
Please don't provide handwriting solution
What is the final volume of the individual PCR reactions we are making?
The typed picture is how my teacher did it and he wants me to solve the hand written one and I have no clue on how to do it , if you can solve it with steps on how to it it would be incredible helpful thanks !
An optimum ligation reaction should contain approximately 50 ng of vector. Given yourconcentrations recorded below, what is the volume of vector that should be added to eachligation reaction to have this mass of DNA in the reaction? Size of asPink-promoterless in bp: 702 (vector) Size of pCusC in bp: 157 The concentration of digested & purified PCR insert: 13.849 The concentration of digested and purified plasmid: 6.887 Any help with this is appreciated. I'm a bit confused thx
You need to complete the following steps for an experiment. Explain whether an acrylamide gel or an agarose gel is more appropriate to use for the following experiments. Purifying tRNA from total RNA Isolating a vector insert for cloning Analyzing PCR products
A linear DNA fragment was produced by digestion with the restriction enzyme, Xba1. This fragment with XbaI(X) sites on both ends was then further digested with HindIII (H) and EcoRI (E). Draw a restriction map of the linear fragment based on the gel electrophoresis results shown below. X H Marker E H/E __2000bp __ __1500b __1300bp __ __ __1000bp __ __700bp __ __500bp __400bp __300bp __ __200bp __ __ __100bp