A linear DNA fragment was produced by digestion with the restriction enzyme, Xba1. This fragment with XbaI(X) sites on both ends was then further digested with HindIII (H) and EcoRI (E).  Draw a restriction map of the linear fragment based on the gel electrophoresis results shown below.  X         H         Marker             E          H/E                           __2000bp __                    __1500b                         __1300bp        __             __        __1000bp                    __                         __700bp             ­­__        __500bp                         __400bp                         __300bp                      __                         __200bp          __        __                         __100bp

Q: On the gel shown below are four DNA samples. Samples A to C are taken from tissues of landslide…

A: The gel electrophoresis is used to separate the DNA fragments according to their sizes. The smaller…

Q: What is the size of the PCR product (Hse gene) observed from the gel photo?

A: ** The expected size of PCR product is 357+280bp, or 637np.                                     **…

Q: Sickle cell anaemia is caused by a mutation in the HBB gene. The normal wild-type βA allele contains…

A: Sickle cell anemia is a result of a mutation in the HBB gene. This gene contains the restriction…

Q: A PCR reaction was performed to amplify the CHE2 gene. The PCR primers used were designed to amplify…

A: Polymerase chain reaction is a molecular biology technique that is sued to synthesize multiple…

Q: Lane 5 in the gel above displays the pBashi cleavage products after restriction digest with the…

A: The type of restriction enzymes that cut double stranded DNA at a particular spot is known as…

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: Consider the following image of a stained agarose gel representing the separation of a plece of DNA…

A: Gel electrophoresis is a biochemical technique in which macromolecules such as DNA  can be separated…

Q: Use the gel to answer the following questions. You will be constructing a map of the plasmid,…

A: Plasmids have been used in genetic engineering for cloning and expression. These carry the genes for…

Q: 3000 bp 2000 bp 1000 bp 800 bp 700 bp 500 bp L Uncut EcoRI 1 BamHI Ncol EcoR1/BamH1 BamHI/Nco1…

A: Use the gel to answer the following questions. You will be constructing a map of the plasmid,…

Q: following question is related to Restriction Enzymes and RFLP. Using EcoRl, which DNA sequence held…

A: Restriction enzymes, also known as restriction endonucleases, are a key tool in molecular biology.…

Q: A Western blot is seen in the picture above. Sodium dodecyl sulfate gel polyacrylamide gel…

A: The western blot, also known as western blotting, is a molecular biology and immunogenetics…

Q: When using the plasmid shown below for cloning, which restriction enzyme site(s) (all indicated with…

A: A plasmid is a double-stranded DNA molecule that is small and circular in shape.  Bactria and yeast…

Q: Select all the following statements that are correct regarding agarose gel electrophoresis and…

A: Agarose gel electrophoresis is a process used for separation of DNA fragments. Steps of agarose gel…

Q: EcoRI 290 bp 3800 bp EcoRI PUC19 PUC19 3400 bp Bgll EcoRI 290 bp EcoRI 1900 bp PUC19 1500 bp

A: A plasmid circular, small, extra chromosomal double stranded DNA (dsDNA). pUC19 plasmid is one the…

Q: Restriction Enzymes with LongerRecognition Sites Produce Larger _______ Fragments

A: The restriction enzyme is the molecular scissors that cut at a specific site. These are naturally…

Q: Positional cloning identifies DNA______________s that arelinked to disease genes.

A: DNA or deoxuribonucleic acid is a polymer of deoxy ribonucleotides connected together via…

Q: The following picture shows the ethidium bromide-stained bands obtained by gel electrophoresis of…

A: Electrophoresis is a molecular technique that employs the electrical field to assort biomolecules,…

Q: Above are the results of gel electrophoresis following digestion with restriction enzymes. What is…

A: Using specialized enzymes known as restriction endonucleases, restriction digestion is a laboratory…

Q: Restriction maps illustrate the lengths of DNA fragments between restriction sites. Which of the…

A: Restriction mapping is a technique to map unknown segment of DNA by breakung it into small…

Q: DNA samples from four individuals were cleaved with the same MW restriction endonuclease. The DNA…

A: Any human biological specimen taken or preserved for the purpose of extracting and analysing DNA in…

Q: -Carefully examine the figure below. Write figure captions that explain the NER DNA repair process…

A: Nucleotide excision repairs cats on the damaged areas of the DNA(deoxyribonucleic acid). It involves…

Q: -gene--- 5'-GTCGACAAGCTTAAGCCTAAGCTTTAGCGAAGCTTGTCGAC-3' Recognition sites Sall 5'-GTCGAC-3'…

A: Sticky ends are short single-stranded overhanging segments of one DNA strand after the Double DNA is…

Q: An 800 bp fragment is completely digested with a single restriction enzyme. Fragments of 50*, 150*,…

A: Restriction enzymes are those enzymes which recognize and cleave at a particular sequence. In this…

Q: Which two restriction enzymes could be used to cut this DNA sequence?…

A: Restriction enzymes are proteins that recognize specific DNA sequences and cut the DNA at or near…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.