(THIS IS NOT GRADED.) This is NON-MANDATORY homework for a practice assessment. I need some assistance with these questions, so I can use them for studying material. Thank you so much! I highly appreciate it! (I am using this for study material.) 17. Carefully examine the figure below. Write figure captions that explain the NER DNA repair processbelow. NER is repairing thymine dimers in this case.j'.3'.5'UvrAB-complexUvrcj'..3'5'Cut3'Cut.3'l'..D Uvr DBDNA polymerase I- 3'.DNA ligase3'l..o in

Nucleotide excision repairs cats on the damaged areas of the DNA(deoxyribonucleic acid). It involves…

Answered: -Carefully examine the figure below.…

-Carefully examine the figure below. Write figure captions that explain the NER DNA repair process below. NER is repairing thymine dimers in this case. 3 P.. UvrAB complex UvrC ÎÎ B 3

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 3TYK: Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning...

See similar textbooks

Similar questions

10. V(D)J recombination contributes to the diversity of immunoglobulins, and occurs by:A. Random single-strand nicks in the DNAB. Programmed double-strand breaks in the DNAC. Site-specific recombinationD. Homologous recombinationE. Retrotransposition 11. Zsuzanna Izsvak and coworkers set out to make a functional copy of a nonfunctional transposase in a fish that is estimated to have been nonfunctional for over 14 million years. The functional transposase became known as ____________________.A. Sleeping BeautyB. RumpelstiltskinC. PandoraD. Rip van WinkleE. None of the above 12. Which of the following Tn3 proteins catalyzes recombination to separate the donor and acceptor DNA molecules?A. transposaseB. DNA polymeraseC. RecAD. ResolvaseE. β-lactamase
2. You are planning to clone a gene into the PBR322 plasmid vector. The gene has Bgl II restriction enzyme sites on both the 5' and 3' ends. Restriction enzyme Recognition site 5'... CTGCAG...3' 3... GACGTC... 5 5... GAATTC...3' 3:... CTTAAG. ECORI Hindil Pst I BamH Eco RI 5' Tetracycline Resistance Hind III 5...AAGCTT...3' PBR322 (4.36 kb) Xmalll 3...TTCGAA ... 5' 5... GGATCC...3' 3... CCTAGG...5' 5...CCCGGG...3° 3...GGGCCC ... 5 5... A'G ATCT...3 3... TCTAGA... 51 Bam HI Origin Replication Xma l BglI E. coli PBR322 plasmid showing restriction sites and resistance genes. Pvull With which restriction enzyme would you cut the PBR322 plasmid vector? Give a reason for your answer. You assemble a ligation reaction to join the gene to the plasmid DNA. What types of product would you expect to obtain from the ligation reaction? Please consider the selection marker genes, Ampicillin resistance gene and Tetracycline resistance gene. What would the antibiotic resistance phenotype be of a…
Please help me
Below is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA CTAAAGCTTCGGGCATTATCG 3' GATTTCGAAGCCCGTAATAGC TATCGACS Consider the following primer which binds to the DNA replication bubble on the diagram above: 5'-GCUAUCG-3' Identify the DNA sequence to which this primer would bind and the orientation. If the replication fork moves to the right, will the primer be used to create the leading strand of replication or the lagging strand? Explain your answer b. If the replication fork moves to the left, will the primer be used to create the leading strand of replication or a. the lagging strand? Explain your answer. What would the next five nucleotides added to the primer by DNA polymerase? С.
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
Reciprocal strand exchange is associated with ... O DNA photolyase site-specific recombination general recombination O DNA excision/repair
Explain why cuts are made on both sides of the damaged region of the DNA.
Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning vectors? a. The plasmid must have resistance to accept DNA inserts. b. They allow the detection of plasmids that contain an inserted DNA fragment. c. They ensure the presence of the ori site. d. They ensure that the plasmid can be cut by a restriction enzyme. e. They allow identification of bacteria that have taken up a plasmid.
1. Cytosine deamination, in which cytosine is mutated to uracil, occurs spontaneously in DNA at a rate of 1 out of 107 cytosines in 24 hours. tofo NH₂ 'N cytosine deamination ----ဝိ NH spr a. If cytosine deamination occurs and DNA polymerase replicates the DNA with this altered base, what mutation would be introduced into DNA? b. Cytosine deamination is so common that DNA repair enzymes recognize uracil and replace it with cytosine. Given this information, why is it essential for DNA, the carrier of the genetic blueprint, to utilize thymine, not uracil, as a base?
25. The restriction enzymes Kpnl and Acc651 recognize and cleave the same 6-bp sequence. You have a plasmid and a linear DNA strand that both contain a Kpnl and Acc651 sequence in the same orientation as shown below. You digest both DNA pieces with both enzymes and then attempt to ligate the sticky ends, followed by treatment with DNA ligase. What will happen? 5' GGTACC3' 5' G G T ACC 3' 3' CCATGG 5' y CCATGGS Kpnl Acс651 A) You will produce sticky ends but the two types of ends will not ligate. Instead, you may produce a small amount of religated plasmid where the digested plasmid sequence re-inserts. B) You will produce a recombinant plasmid in which the linear DNA strand is ligated in between the two sites, suitable for cloning. C) You will produce blunt ends that will not ligate because the two restriction enzymes will both operate on both of the sites. D) All the DNA will be completely digested as if you had applied a general DNAse enzyme.
A host cell has successfully taken up a recombinant pUC18 plasmid but the plasmid bears mutated origin of replication. Which of the following will happen to that host cell following amplification process on a media containing ampicillin and X-gal? * I It fails to form a colony on the media It survives in the media It would not be able to digest X-gal II III I and II only O I and III only Il and III only I, Il and III
25. The restriction enzymes Kpnl and Acc651 recognize and cleave the same 6-bp sequence. You have a plasmid and a linear DNA strand that both contain a Kpnl and Acc651 sequence in the same orientation as shown below. You digest both DNA pieces with both enzymes and then attempt to ligate the sticky ends, followed by treatment with DNA ligase. What will happen? 5' GGTACC3' 5' GGTACC3' 3 CCATGGS 3 CCATGGS Kpnl Aсс651 A) You will produce sticky ends but the two types of ends will not ligate. Instead, you may produce a small amount of religated plasmid where the digested plasmid sequence re-inserts. B) You will produce a recombinant plasmid in which the linear DNA strand is ligated in between the two sites, suitable for cloning. C) You will produce blunt ends that will not ligate because the two restriction enzymes will both operate on both of the sites. D) All the DNA will be completely digested as if you had applied a general DNAse enzyme.