Your company has decided to develop a PCR test that will be used to determine Huntington's disease. This genetic test will consist of a single PCR-amplification reaction of genomic DNA that will attach to the disease's gene either side of the repeated region to ensure amplification. Which of the following properties do you need consider when designing the orientation of the two primers relative to the template DNA? a) The primers’ 5′ → 3′ orientations must point toward each other when bound to the template. b) The primers’ 5′ → 3′ orientations must point away from each other when bound to the template. c) The primers’ 5′ → 3′ orientations must go in the same direction when bound to the template. d) The primers must be complementary to each other and to the template.

Q: The human hexokinase enzyme has the same function as the bacterial hexokinase enzyme but is somewhat…

A: Promoters are upstream regions of a gene that are used to initiate and control gene expression. The…

Q: 1. Look at the cut DNA sequences shown below in i) and ii). a) What restriction enzyme(s) was/were…

A: To help you better understand the answers above, here are non-technical explanations of each…

Q: On the gel shown below are four DNA samples. Samples A to C are taken from tissues of landslide…

A: The gel electrophoresis is used to separate the DNA fragments according to their sizes. The smaller…

Q: Design PCR primers for the DNA sequence given below and explain your choice. As part of your answer,…

A: It is a Polymerase Chain Reaction, which is a mechanism for multiplying a specific piece of DNA…

Q: Consider the following experiment. First, large populations of two mutant strains of Escherichia…

A: Mutation  The change in DNA sequence by either deletion, addition, duplication, transversion, or…

Q: You are engineering a new vector that contains a screenable marker that can be used for blue/white…

A: Three important points to remember about the blue-white test: a special substrate is used which is…

Q: Specifically, why is the primer needed in order for DNA ploymerase to start synthesis? A ) primers…

A: Always replication, Transcription starts from 5' to 3'. Addition of nucleotide takes place at 3'-OH.

Q: Now that you’ve isolated the gene and made lots of copies, you need to insert the gene into…

A: Plasmids are used in genetic engineering to increase the number of copies of a gene. A plasmid is a…

Q: Following a dye terminator DNA sequencing reaction using 2',3'-dideoxynucleotide triphosphates…

A: Dye terminator DNA sequencing is the modern version of Sanger sequencing. It uses…

Q: Many of the gene products involved in DNA synthesis were initially defined by studying mutant E.…

A: During DNA replication another copy of DNA is synthesized on DNA template strand using Polymerase…

Q: The 3′-exonuclease activity of E. coli DNA polymerase I was found to show no discrimination between…

A: Introduction: DNA is the type of nucleic acid that is the genetic material of the living body,…

Q: 1) polymerize chain reaction is an experimental method for making multiple copies of segments of DNA…

A: Questions :    1) polymerize chain reaction is an experimental method for making multiple copies of…

Q: Amplified target regions of four different samples were separated using gel electrophoresis.  DNA…

A: Gel electrophoresis is a lab technique for separating DNA, RNA, and protein mixture based on their…

Q: Examine the sequence for the DNA fragment below. Your job is to design primers for PCR that would be…

A: A primer may be a brief single-stranded nucleic acid utilized by all living living beings within the…

Q: Transposon mutagenesis

A: Transposons: These are also known as jumping genes. These are the segments of DNA which can move or…

Q: complimentary sticky ends

A: DNA's are cut by using restriction enzymes ( endonuclease or exonuclease) which produce sticky or…

Q: When linear DNA is sequenced, the nucleotide base pairs are numbered from the start to finish. a DNA…

A: DNA is the genetic material present in all living cells. It carries information from one cell to…

Q: you wanted to design two primers to PCR amplify a gene from an organism that has 4 chromosomes, each…

A: In PCR that is, polymerase chain reaction two primers are needed  to hybridize with the sample DNA…

Q: The following diagram shows the two strands of a single DNA molecule, with a pair of PCR primers…

A: PCR or polymerase chain reaction is a rapid and versatile in vitro technique for amplification of…

Q: Our PCR samples already contain loading dye, but sometimes this isn’t the case. If your samples…

A: Gel electrophoresis is a process that helps in the separation of DNA fragments based on sizes with…

Q: 5'-GATTACAATAGGAATTC~~ GAATTCTCGTGACTCCG-3' 3'-CTAATGTTATCCTTAAG~ CTTAAGAGCACTGAGGC-5' Which of the…

A: PCR or polymerase chain reaction is a DNA amplifying technique where a short piece of a gene or a…

Q: To generate large amounts of DNA to manufacture gene therapy payloads or to be able to see them on…

A: Specific sequences can be amplified by PCR in order to generate large amounts of DNA to manufacture…

Q: In producing genetically engineered human insulin in bacteria, why is it important to use the…

A: Insulin is a natural peptide hormone produced by the beta cells of the pancreas in response to high…

Q: The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product…

A: Agarose gel electrophoresis used to separate DNA according to its molecular weight. On agarose gel,…

Q: If you wanted to create recombinant DNA using this enzyme(3' T A 5'), would you have to cut both…

A: DNA recombination is a technology in which DNA from different sources is isolated and recombined to…

Q: are using the restriction enzyme HAEIII to digest different samples of the taster gene isolated from…

A: In gel electrophoresis DNA to be tested is broken down by various restriction endonucleases into…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.