Following a dye terminator DNA sequencing reaction using 2',3'-dideoxynucleotide triphosphates (ddNTP's), separation of the primer reaction products was achieved using capillary gel electrophoresis. In the following example, ddATP was labeled with a 'green' fluorophore, ddTTP was labeled with 'red', ddCTP was labeled with 'black', and ddGTP was labeled with 'blue. From left to right (i.e., the shortest to longest retention time), the sequence was: AACGGTTGTCTCTGATTTGTATTATGTT. What is the sequence of the template DNA, from its 3' to 5' end? о ТTGCCAACAGAGACTAAACATAАТАСАА O TTGTATTATGTTTAGTCTCTGTTGGCAA O ААCАТААТАСАААТСАGAGAСААССGTT AACGGTTGTCTCTGATTTGTATTATGTT

Q: During your experiment you analysed only a few of the recombinant clones for the presence of the…

A: A Genomic library consists of the total genomic DNA of an organism. This DNA can be stored inside…

Q: Consider the following experiment. First, large populations of two mutant strains of Escherichia…

A: Mutation  The change in DNA sequence by either deletion, addition, duplication, transversion, or…

Q: What was the function of each solution or step in the DNA purification protocol? The following…

A: Deoxyribonucleic acid extraction is the isolation and purification of DNA from sample using a…

Q: In PCR amplification reaction, 5 mM EDTA was erroneously added to your final reaction, and you did…

A: Please follow step 2 for detailed explanation.

Q: A recombinant protein corresponding to 52 repeats of the peptide sequence YSPTSPS was covalently…

A: The peptide sequence YSPTSPS is a known phosphorylation site that corresponds to the heptad repeat…

Q: The 3′-exonuclease activity of E. coli DNA polymerase I was found to show no discrimination between…

A: Introduction: DNA is the type of nucleic acid that is the genetic material of the living body,…

Q: DNA from 100 unrelated individuals from one population of Chinook salmon were amplified at a single…

A: A population is said to be in Hardy Weinberg equilibrium if it satisfies 2 equations; p+q+r=1 and…

Q: In the Avery, McLeod, McCarty Experiment where supernatant from heat killed, virulent S Strain…

A: Avery, McLeod and McCarty experiment was used to determine the genetic material and its nature on an…

Q: In a cotransformation experiment DNA was isolated from a donor strain that was proA+ and strC+ and…

A: DNA (Deoxyribo-Nucleic acid) is the double stranded genetic material in all prokaryotic and…

Q: In a Sanger sequencing reaction, the template DNA is shown below, with the short sequence on top as…

A: In a Sanger sequencing reaction, the DNA to be sequenced (the template) is mixed with a primer, DNA…

Q: Amplified target regions of four different samples were separated using gel electrophoresis.  DNA…

A: Gel electrophoresis is a lab technique for separating DNA, RNA, and protein mixture based on their…

Q: Transposon mutagenesis

A: Transposons: These are also known as jumping genes. These are the segments of DNA which can move or…

Q: Here you see the gel electrophoresis of PCR reactions of the pMCT118 VNTR locus of 4 individuals…

A: Answer pMCT118 VNTR  locus has multiple repeats that can be analyzed by Polymerase chain reaction…

Q: Suppose you have to design two PCR primers, 16 bases in length, to amplify the whole of the 100 bp…

A: Primers are short nucleic acid molecule, that are single stranded in nature and area prerequisite…

Q: 5'-GATTACAATAGGAATTC~~ GAATTCTCGTGACTCCG-3' 3'-CTAATGTTATCCTTAAG~ CTTAAGAGCACTGAGGC-5' Which of the…

A: PCR or polymerase chain reaction is a DNA amplifying technique where a short piece of a gene or a…

Q: In a cotransformation experiment (see question 4 of More GeneticTIPS), DNA was isolated from a donor…

A: Co-transformation occurs when the two or more genes are located in very close proximity that they…

Q: To generate large amounts of DNA to manufacture gene therapy payloads or to be able to see them on…

A: Specific sequences can be amplified by PCR in order to generate large amounts of DNA to manufacture…

Q: A PCR reaction was performed to amplify the XULA3 gene, which is bp 882-5,364 on a plasmid that is…

A: The Polymerase chain reaction is a laboratory technique that is used to make multiple copies of a…

Q: The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product…

A: Agarose gel electrophoresis used to separate DNA according to its molecular weight. On agarose gel,…

Q: What is the cause of an extra band in a DNA ladder in agarose gel electrophoresis?

A: The following can lead to the formation of an extra band in the DNA ladder lane - 1. Contamination -…

Q: are using the restriction enzyme HAEIII to digest different samples of the taster gene isolated from…

A: In gel electrophoresis DNA to be tested is broken down by various restriction endonucleases into…

Q: Perform the Megaprimer PCR procedure (in scheme A). Indicates the number of Primers required in the…

A: The Megaprimer PCR method is a technique used for introducing specific mutations, deletions, or…

Q: In hybridizing microarrays, we use a solution that contains {3X SSC, 0.5% SDS, 5ug/ml salmon sperm…

A: The ratio of mass of solute present in a solution relative to the volume of the solution represents…

Q: DNA samples from four individuals were cleaved with the same MW restriction endonuclease. The DNA…

A: Any human biological specimen taken or preserved for the purpose of extracting and analysing DNA in…

Q: Ehat  primer sets could be amplify the following DNA sequence?   AATACGTCGCATGGggatccttttttatgcatg

A: Amplification of DNA sequence is done by the polymerase chain reaction. With the help of DNA…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.