sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers to amplify the sequence that is in bold and our chosen primers within the underlined region rather than in the flanking sequence.) CAGTTAACTGGTТАТАAGAAACCTсстТCAAGAGAGсТТАААGTTACATIшссстеAстTAААТGGTG TGTGGTGGCTATTGATTATAAACACTACACACCCTCTTI TAAGAAAGGAGCTAAATTGTTACATAAACC-3 Nhat is the 5' to 3' sequence of the reverse primer? O 5-TTC GTC CAA AGA ATA TTC-3
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.


Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images









