2) The partial coding sequence of the Spike protein for SARS- COV-2 is shown below: You are tasked with designing 2 primers to clone this gene by PCR amplification. What are the sequences of the two 21bp primers in the 5' to 3' orientation that will allow you successfully amplify this gene? АTGTTTGTTTTСТTGTTTTATTGССАСТАGTСТСТAGTCAGTGTGTTААТСТТАСААССAGAACTCAATTAСССССТGCATAСАСТААТТСТТТСАСАС GACCAGTTGCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAAGGAGTCAA/ O A) ATGTTTGTTTTTCTTGTTTTA and GTCAAATTACATTACACATAA O B) TAAAACAAGAAAAACAAACAT and TTATGTGTAATGTAATTTGAC O C) ATGTTACTTGGTGACCAGTTG and GTCAAATTACATTACACATAA O D) ATGTTTGTTTTTCTTGTTTTA and TTATGTGTAATGTAATTTGAC

Q: You have isolated a cDNA clone encoding a protein of interest in a higher eukaryote. This cDNA clone…

A: cDNA  It is known as complementary DNA and made up of reverse transcription of mRNA.

Q: What would three possible reasons be that a PCR wouldn't work after cloning a TAQ sequence into a…

A: Even though you've verified Taq protein expression through SDS-PAGE, your PCR might still fail for a…

Q: CONTROL   Baseline Amiloride Forskolin Inh172 Vte (mV) -78 -2 -4 -3 DVRt (mV) 8 16 7.5…

A: To calculate the current flowing through ENaC and CFTR for both vectors, we need to use the values…

Q: You have cloned a gene that codes for phosphoglycerate mutase from Leishmania mexicana (Lm- PGAM)…

A: Gene cloning is the technique to produce the exact copies of the desired gene by utilizing genetic…

Q: Two homologous chromosomes in ES cells are depicted below with the portion of your gene of interest…

A: CRISPR/Cas9 creates specific double-stranded breaks at the target locus that trigger DNA repair…

Q: Describe the banding pattern seen in the gel. What does that tell you about the role of annealing…

A: Gel electrophoresis is a laboratory technique for separating charged molecules such as DNA, RNA, and…

Q: You are employed in a gene therapy laboratory to test the effectiveness of a vector for correcting…

A: Cystic Fibrosis Transmembrane Conductance Regulator is referred to as CFTR. It is a protein that is…

Q: True or False: 1. The 6X HIS tag is required for a eukaryotic protein to be expressed in E. coli 2.…

A: Polyhistidine tag is added to a protein and helps in its purification. A recombinant protein can…

Q: 49 Identify which PCR primer that could be used to amplify the gene shown (choose all correct…

A: Since there are multiple questions in this particular question, I will answer the first one for you.…

Q: Why are restriction endonucleases considered a bacteria’s “innate immune system”? Why is…

A: Restriction endonucleases, also known as restriction enzymes, are enzymes that are found in bacteria…

Q: For a coding gene, purifying (negative) selection will result in more synonymous (silent) site…

A: Purifying selection is the most predominant form of natural selection or negative selection. As it…

Q: Genetic engineers would like to insert the gene for producing thrombin, a protein that facilitates…

A: Genetic engineering is the process of modifying an organism's genetic makeup using recombinant DNA…

Q: You are engineering a new vector that contains a screenable marker that can be used for blue/white…

A: Three important points to remember about the blue-white test: a special substrate is used which is…

Q: You discover a new gene cluster from a strain of the bacterium Streptomyces. The domains of the…

A: Polyketides(PKs) and non-ribosomal peptide hybrids(NRPS) are important class of natural products,…

Q: 2). a). You mutagenize phage X and obtain three mutants that no longer cause plaques when incubated…

A: In a cis test, allelism is determined by crossing two mutants on the same phage chromosome. If the…

Q: You are attempting to prepare a single gene knockout library using the pRL27 transposon system. You…

A: * Given that prepared a single gene knockout library using the pRL27 transposon system. *Then grows…

Q: Now that you understand how the CRISPR-Cas9 system works, think back to the experiments discussed in…

A: CRISPR-Cas9 is a genome editing tool. It helps researchers to edit or change the gene from the…

Q: Please make this as SIMPLE as possible Question: regarding to horizontal gene transfer

A: Horizontal gene transfer mainly occurs in prokaryotes.

Q: Prior to the publication of the article from which this assay comes from (picture), the Cas9…

A: SDS-PAGE Analysis of Cas9 Orthologsa. Experimental Question and HypothesisResearch Question: The…

Q: STEP BY STEP Exaplanation would be appreciated so I can understand for upcomming exam. In humans,…

A: Given that  GG =570 GT = 297 TT =33  Total population = 894

Q: For a molecular cloning experiment using the bacterial strain E. coli K12 is used to insert the gene…

A: Recombinant DNA technology uses enzymes and a variety of laboratory procedures to modify and isolate…

Q: Below is a portion of an exon from a gene that encodes protein Y in the genome of the plant…

A: Ans 1 :  Yes, there is a mutation in third codon when counting from 5/ to 3/ on template strand in…

Q: Select two primers from the list below such that your selected primers create a pair capable of…

A: Primer is a short strand of nucleotide sequence which helps in synthesis of DNA. After the…

Q: Besides cloning vectors, there are also expression vectors. What is the main differenc between these…

A: cloning vector is a small piece of DNA that can be inserted into organism for cloning purpose.…

Q: The xyz gene product, encoded by a new viral strain, has corresponding human homologs. Blast…

A: Substitution matrix is used to sequence the aligned position. The substitution matrix is of two…

Q: occurring

A: The Department of agriculture regulates field testing of GM crops for research. The environmental…

Q: The cellulase gene of Bacillus licheniformis was successfully cloned into the pET21a vector and…

A: Answer (i). The antibiotic ampicillin was added to the LB agar because the pET21a vector into which…

Q: What is homologous recombination and where/when does it typically take place in an organism.…

A: Homologous recombination is a genetic exchange process that occurs between two similar or identical…

Q: You are employed in a gene therapy laboratory to test the effectiveness of a vector for correcting…

A: Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations can be fixed using the…

Q: What is the size of the current that flows through ENaC for both vectors? Control:  97mA.cm2…

A: CFTR stands for Cystic Fibrosis Transmembrane Conductance Regulator. It is a protein that is…

Q: 1) Enhanced GFP protein has: An excitation peak at 488nm and emits maximally at 507nm. An excitation…

A: Answer 1.  Answer. 1). Enhanced GFP protein has an excitation peak at 488nm and emits maximally…

Q: As seen in the illustration below, you inserted your desired gene into pBR322. You used BamHI to…

A: A cloning vector like the pBR322 plasmid has some important features - an origin of replication,…

Q: Bacteriophage lambda is as one of the routinely used molecular cloning vectors, which alsoserved as…

A: Gene cloning is a process in which our gene of interest is located into the gene and copied (cloned)…

Q: Generate a primer pair that is 6 base-pairs long to amplify the inversion, that will notamplify…

A: A primer pair is a set of short, synthetic DNA sequences that are designed to hybridize to opposite…

Q: Once cloning is complete, a recombinant OXA-M290 protein can be produced in E. coli. Competent E.…

A: The addition of IPTG to E. coli BL21(DE3) cells containing the pET-28a-OXA-M290 plasmid induces the…

Q: Besides the pUC series, there are other plasmid vectors in the market such as pBR327 and pGEM-T.…

A: Cloning methods are used in biotechnology for various purposes. TA cloning is the technique that…

Q: he steps to replicate the identified spike protein are as follows: . Find the CDNA sequence of the…

A: Gene expression is a phenomenon in which gene is expressed into a particular protein. It is a very…

Q: You are employed in a gene therapy laboratory to test the effectiveness of a vector for correcting…

A: The CFTR gene encodes the CFTR protein (cystic fibrosis transmembrane conductance regulator). It is…

Q: You are employed in a gene therapy laboratory to test the effectiveness of a vector for correcting…

A: Introduction: CFTR stands for Cystic Fibrosis Transmembrane Conductance Regulator. It is a protein…

Q: The human gene for hemophilia is on the X chromosome. Below is a pedigree from a family afflicted…

A: Hi, Thanks For Your Question.  Answer : Correct Option Is b (20%) Explanation :  P (III-7 Is…

Q: the forward primer used in this experiment incorporates part of the cell recognition site, GGCC. How…

A: The TAS2R38 gene in individuals encodes a protein known as taste receptor 2 member 38. TAS2R38 is a…

Q: i) Suppose we want to insert the GFP sequence after the promoter of a gene X to create a fusion…

A: The CRISPR Cas9 system is a tool for cutting a DNA at a particular location. This system has 2…

Q: Below is the DNA sequence (coding strand) for the human placental protein 14 (not all of the gene…

A: PCR stands for Polymerase Chain Reaction. It's a widely used laboratory technique in molecular…

Q: Please DESCRIBE, in outline form, the method you will use to select for bacterial cells that have…

A: In this question, we are asked to outline the method for selecting bacterial cells that have taken…

Q: After mutagenesis of wild type Vibrio fisheri, you isolate two different mutant strains (A and B)…

A: Mutagenesis is a process of exposing organisms to mutagens such as chemicals, radiation, or viruses…

Q: A possible forward primer to be designed is a primer that binds to the region of the OXA-M290 gene…

A: Cloning is a fundamental technique in molecular biology that involves inserting a gene of interest…

Q: You receive purified mRNA encoding the peak protein of SARS Cov-2 as well as the plasmid pET32 (a…

A: DNA cloning with plasmid vector involves the addition of a foreign gene into a plasmid vector. The…

Q: You are engineering a new vector that contains a screenable marker that can be used for blue/white…

A: A DNA molecule known as a cloning vector is used to introduce foreign genetic material into a host…