1) You would like to clone a gene by PCR. The sequence of the two ends of the coding strand for the gene is provided below. АTGAAATCTАCGTTTCAC .. СССССAGTACCCCССТТА ................ Which following pair of primers would direct the amplification of this gene? All sequences are written from 5' to 3'. а. АTGAAATCТАCGTTTCAС; ССССАGTCСССССТТА b. ATGAAATCTACGTTTCAC; TAAGGGGGGTACTGGGGG c. TACTTTAGATGCAAAGTG; ATTCCCCCCATGACCCCC d. GTGAAACGTAGATTTCAT; ATTCCCCCCATGACCCCC

Q: Your company has decided to develop a PCR test that will be used to determine Huntington's disease.…

A: The polymerase chain reaction (PCR), is one of the most useful molecular biology techniques used to…

Q: 1. Look at the cut DNA sequences shown below in i) and ii). a) What restriction enzyme(s) was/were…

A: To help you better understand the answers above, here are non-technical explanations of each…

Q: Design PCR primers for the DNA sequence given below and explain your choice. As part of your answer,…

A: It is a Polymerase Chain Reaction, which is a mechanism for multiplying a specific piece of DNA…

Q: During your experiment you analysed only a few of the recombinant clones for the presence of the…

A: A Genomic library consists of the total genomic DNA of an organism. This DNA can be stored inside…

Q: A method for detecting methylated CpGs involvesthe use of a chemical called bisulfite, which…

A: Hi! Since you have posted multiple questions, we are answering only first three sub-parts. Primers…

Q: Although many cloning applications involve introducing recombinant DNA into bacterial host cells,…

A: Cloning can be defined as the process by which identical copies of the organisms are created. More…

Q: You are interested in amplifying the putative gene encoding the 480-bp protein TMR (Total Memory…

A: We are given with the gene that is needed to be amplified by PCR. The image shows a region of DNA…

Q: You are engineering a new vector that contains a screenable marker that can be used for blue/white…

A: Three important points to remember about the blue-white test: a special substrate is used which is…

Q: You obtained the sequence of the frog gene X you amplified in Question #16 through a process called…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: You want to clone the Human Gene A into a plasmid for producing the Protein A in bacteria. GeneA…

A: Introduction :- A plasmid is a small, circular, double-stranded DNA molecule that is separate from…

Q: The sequence at one end of one strand of the Drosophilatransposon Mariner is shown below (dots…

A: The genes are the sequence of nucleotides that are present on the chromosomes and encode for a…

Q: Forty years after its development, the use of recombinant DNA technology is widespread and is found…

A: The technique that deals with the incorporation of a foreign or desired DNA fragment into another…

Q: Which of the following is not true of cDNA produced usinghuman brain tissue as the starting…

A: Introduction  Central Dogma: it is the key mechanism by which DNA can be transcribed into mRNA by…

Q: ain A: wild type........ .CT value of 15 ain B: has mutation X in the promoter region........CT…

A: Quantitative reverse transcription polymerase chain reaction, also called RT-qPCR, is a molecular…

Q: Before this experiment, Dr Merrick didn’t know whether the OBP that he cloned was a type of…

A: Proteins can be monomeric or oligomeric. Monomeric proteins have a single subunit (single…

Q: Many of the gene products involved in DNA synthesis were initially defined by studying mutant E.…

A: During DNA replication another copy of DNA is synthesized on DNA template strand using Polymerase…

Q: You are asked to sequence a piece of DNA to determine if it is from a gene thought to be involved in…

A: DNA sequencing is an important technique used to determine the sequence of unknown fragments of DNA…

Q: You obtained the sequence of the frog gene X you amplified in Question #16 through a process called…

A: A linear polymer of nucleotides is called as nucleic acid. DNA (Deoxyribonucleic acid) and RNA are…

Q: 1) polymerize chain reaction is an experimental method for making multiple copies of segments of DNA…

A: Questions :    1) polymerize chain reaction is an experimental method for making multiple copies of…

Q: You obtain the DNA sequence of a mutant of a 2-kb gene in which you are interested and it shows base…

A: the mutation is the change or error that is caused in the chromosome it is of a different type 1.…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…

Q: Researchers are manipulating the gene cxx2 for their experiments, and they have inserted a small…

A: As per the central dogma of biology, the flow of genetic information is from DNA -> RNA ->…

Q: In generating mutations in a bacterial gene involved in antibiotic resistance, a number of point…

A: Mutations are unexpected and unforseen alterations takes place inside the genetic material of an…

Q: . The position of the gene for the protein actin in the haploid fungus Neurospora is known from the…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Transposon mutagenesis

A: Transposons: These are also known as jumping genes. These are the segments of DNA which can move or…

Q: You are trying to study the effects of Drug A on the expression of Gene X in a tumor sample (lane…

A: Reverse transcription enzyme chain reaction (RT-PCR) may be a variation of normal PCR that involves…

Q: please solve the  following: (a)Explain how a mutation effects a genotype. (b) Explain how a…

A: The genotype refers to the hereditary material passed among generation, and the phenotype is…

Q: 5'-GATTACAATAGGAATTC~~ GAATTCTCGTGACTCCG-3' 3'-CTAATGTTATCCTTAAG~ CTTAAGAGCACTGAGGC-5' Which of the…

A: PCR or polymerase chain reaction is a DNA amplifying technique where a short piece of a gene or a…

Q: The genome of a typical bacterium contains about 5 x 106 base pairs, and can be replicated in about…

A: Replication is the process of synthesis new daughter DNA strand using the existing parental DNA…

Q: The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product…

A: Agarose gel electrophoresis used to separate DNA according to its molecular weight. On agarose gel,…

Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…

A: DNA replication is a phenomenon in which DNA make itself using Enzyme DNA Polymerase . It occurs in…

Q: The authors investigate if the switch from the polymerase to the exonuclease site involves releasing…

A: During DNA replication, accuracy is determined by rate of nucleotide incorporation by DNA…

Q: assess anatomical distribution of gene expression.   genomic pcr nortbern blotting Rnai in situ…

A: The genes are the functional part of the DNA that undergoes transcriptional process and ultimately…

Q: Ehat  primer sets could be amplify the following DNA sequence?   AATACGTCGCATGGggatccttttttatgcatg

A: Amplification of DNA sequence is done by the polymerase chain reaction. With the help of DNA…

Q: A person with a rare genetic disease has a sample of her chromosomessubjected to in situ…

A: The word insitu derived from the Latin word that means in place. This suggests that the…

Q: r it 6- Complete the following: a) Two fragments of DNA can be joined by a b) Restriction enzymes…

A: Recombinant DNA technology is the process by which we can isolate our gene of interest and then…

Q: Genome annotation refers to ... 1.) lining up overlapping regions in short shotgun sequencing reads…

A: Introduction:- Genome consists of all the genetic and biological information of an individual…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.