After Drosophila DNA has been treated with a restrictionenzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun”technique, every DNA sequence of Drosophila in a librarycan be recovered.a. How would you identify a clone that contains DNAencoding the protein actin, whose amino acid sequenceis known?b. How would you identify a clone encoding a specifictRNA
Q: 47. Protein Sequencing Applies changes in pH to separate amino acids Applies changes in pH to sepa...
A: "Since you have posted a multiple question, we will answer the first question for you. If you want a...
Q: drofofo %3D P-o-P-o- 6- o- o-P-o-P-o- -오-오 O oxidoreductase O isomerase O lyase O hydrolase O ligase...
A: The enzymes are classified into six different groups based on the reaction it catalyzes. The differe...
Q: What are the factors necessary for the rapid absorption of sugars?
A: Carbohydrates are defined as the poly hydroxy aldehydes or ketones with an emperical formula CX(H2O)...
Q: From natural to synthetic ingredients in perfumery Explain and give example
A: When we smell perfume, we recognise certain fragrances. Scents of flowers, fruits, some foods, leath...
Q: C
A: This question can only be answered hypothetically by taking the standard Rf values of some polar ami...
Q: How much ATP and CO2 can be derived from 500 g of lactose?
A: Lactose is a disaccharide made up of galactose and glucose ...
Q: Four amino acid samples were subjected to a reverse-phase chromatography set up and yielded the foll...
A: Amino acids differ from each other on the basis of their side-chain properties. Some amino acids are...
Q: Malonyl-ACP is a precursor in fatty acid synthesis in the acyl carrier protein pathway. Draw the str...
A: Fatty acid synthesis is the formation of fatty acids from acetyl co A and NADH using fatty acid synt...
Q: A. Which of the following molecules in not a reasonable intermediate in the conversion of oxaloaceta...
A: Q. A. Asparagine is the amide of aspartic acid. Oxaloacetate is asparagine's precursor. Oxaloacetate...
Q: rom bottom of vpside-down Inner tube to the top of the layer of bubbles glucose fructose sucrose wat...
A: During this experiment, the parameters that factor in the efficiency of alcoholic fermentation are a...
Q: a sample that contains a carbohydrate delivers a negative starch iodine test. what does this result ...
A: Introduction: Carbohydrates are polyhydroxy aldehydes or polyhydroxy ketones with a molecular formu...
Q: Acid hydrolysis of polypeptides may lead to complete destruction of tyrosine residues.
A: Proteins and peptides are macromolecules made up of covalently bonded amino acid residues in linear ...
Q: Complete the table below visible result after Interpretation Chemical/reagent used (be specific) Tes...
A: Introduction: Carbohydrates are the key source of energy used by living things and present as an abu...
Q: Describe the properties of laboratory-produced protocells.
A: Protocells are structures that arise when abiotic (non-living) components clump together. Despite th...
Q: Draw and name three different functional groups. Draw the basic structure of an amino acid. Show how...
A:
Q: Given the chromatogram below in a normal phase, which samples would be the least polar? O Samples Ba...
A: In chromatography, for comparing relative polarity of the molecules, the retardation factor (Rf) ca...
Q: 14. Subject this amino acid sequence under (1) trypsin (2) chymotrypsin (3) pepsin and (4) CNBr. Gen...
A: Proteolytic enzymes are used to cleave the larger polypeptide into smaller peptide fragments. They c...
Q: What would be the expected effect of this change on the enzyme’s catalytic activity?
A: Enzyme activity is the rate of the reaction catalysed by the enzyme expressed. It is measured as mic...
Q: write the introduction for the effect of denaturing agent on the structure of phycocyanin on two pag...
A: Phycocyanin is a water-soluble pigment protein. It comes from microalgae. It is non-toxic. It has a...
Q: Which of the following would be the correct Haworth projection of a-D-Talose (linear form is in the ...
A: A Haworth projection is a standard manner of formulating a structural formula that uses a basic thre...
Q: 1. Which of these activities occur in ER? You can select more than one. Transcription Translation pr...
A:
Q: Modified true or false. Write the correct answer if the underlined word is false. 1. In ion-exchang...
A: Chromatography is the process of separating a mixture of chemicals into its constituent parts based ...
Q: glyceraldehyde-3-phosphate is synthesized with radioactive hydrogen and added to a solution containi...
A: Glycolysis is a catabolic pathway that converts glucose to pyruvate. It occurs in cytoplasm in serie...
Q: 23. In the concerted model, the most active enzyme form will be when a. All subunits are in the R st...
A: Enzyme can have it's subunits in 2 conformations : Low-activity state -(Tense)T state High-activity...
Q: How many protons are pumped out of the mitochondrial matrix for each pair of electrons extracted by ...
A: The NAD+ dependent Beta-hydroxacyl coA dehydrogenase cataluzes the third step of beta oxidation to f...
Q: Modified true or false. Write the correct answer if the underlined word is false. 1. The zinc ion i...
A: A zinc finger is a tiny protein structural motif defined by the coordination of one or more zinc ion...
Q: Which mixture acts as buffer solutions? O 50 ml 0.1M H2CO3 and 100 ml 0.1M NAOH 100 ml 0.1M H2CO3 an...
A: A buffer solution is composed of a weak acid and its conjugate base. The buffer solution resists the...
Q: In the second reaction of the pentose phosphate pathway that generates NADPH, What are the subtrates...
A: The pentose phosphate pathway also called the hexose monophosphate shunt is an alternative pathway f...
Q: Protein Description A 35 kDa monomer Disulfide-linked homodimer comprised of 19 kDa monomers homodim...
A: Answer - Protein is made by amino acids and in living organisms, 22 types of amino acids exist and...
Q: Disease Z is marked by the accumulation of Metabolite M - a product of the reaction: L→M. This react...
A: Enzyme inhibitors are the substances that bind to Enzyme either at active site or allosteric site so...
Q: A mixture containing arginine, glutamic acid and isoleucine was subjected to electrophoresis at pH 7...
A: Electrophoresis is a technique that is used to separate the biomolecules such as DNA, RNA, peptides,...
Q: Which of the following repair mechanisms would most likely be used to repair a G in DNA damaged by o...
A: Genetic variation is very important for evolution, but genetic stability is crucial for survival of...
Q: Is it ethical to see a severe need for help andnot respond to it directly?
A: Firstly, we need to understand what is a severe need . It may vary from person to person . The sever...
Q: The simplest class (with an example) of carbohydrates. * A.Oligosaccharides: Trehalose B.Monosacch...
A: Carbohydrates are a class of biological macromolecule that can be divided into four types: monosacch...
Q: Which of the following is the most likely explanation for a situation where the ELECTRON TRANSPORT C...
A: The electron transport chain is made up of membrane-embedded proteins and organic compounds that are...
Q: Phytochemical test Physical description of extract: Color: Reddish brown Transparency: Turbid pH: Ac...
A: Antifungal agents are those that act against fungi and their growth. They might inhibit the growth o...
Q: The proofreading of DNA is essential for faithful replication. True False
A: Introduction - DNA polymerase 1 and 2 are known to excise erroneous nucleotides before the introduc...
Q: Hello sir, I khow it lakes preciouS Lab. Sheet-Level time, Please, I have a report on this Semester ...
A: The measure of Cytotoxicity or cytotoxicity assays are required to measure or find out the ability o...
Q: In an experiment, separation of albumin from chicken liver was attempted at 31%, 58%, and 65% satura...
A: Ammonium sulphate is commonly used for protein precipitation, separation, and crystallization. Antib...
Q: Chymotrypsin cleaves the N-terminus side of Phe, Tyr, and Trp. O True O False
A: Q20) Part3. Chymotrypsin is a globular protein that acts as a proteolytic enzyme in the digestion sy...
Q: Question:- 1. Transcribe and translate the given region of DNA, note that the promoter region is to...
A: The Central dogma of molecular biology involves the synthesis of RNA using DNA as template by the pr...
Q: When experiencing stress, the effects of the epinephrine circulating in the body will result in a. b...
A: Therapeutic Epinephrine is a synthetic version of the sympathomimetic amine epinephrine, which has v...
Q: Enzymes that catalyze DNA denaturation or melting are: gyrases topoisomerases helicases ...
A: DNA is a genetic material that is a double stranded structure polymer of nucleotides. DNA replicatio...
Q: What type of reaction is catalyzed by these complexes? Describe the role of dihydrolipoamide dehydr...
A: Dihydrolipoamide dehydrogenase (DLD) is present in pyruvate dehydrogenase complex which catalyzes pr...
Q: ACTIVITY 5.2.3 Make a graphical representation of activation energy and change of free energy in a r...
A: A spontaneous reaction that is thermodynamically favorable is accompanied with a negative change in ...
Q: Given that the reduction potential Eo'= -320, +10, +816, and +50mV for NAD+, fumarate, 02 and G3P DH...
A: NAD+ oxidises glyceraldehyde 3-phosphate, incorporating inorganic phosphate (Pi) to create 1,3-bisph...
Q: quantitatively measure the concentration of carbohydrates
A: Benedict's test is mainly used for detection of reducing sugar in the given analyte solution. It is ...
Q: The enzyme that removes the RNA primer from the Okazaki fragment is: DNA pol III DNA ligase ...
A: Introduction: DNA is the hereditary material that defines every cell. It is found within the nucleus...
Q: Mixtures of amino acids can be analyzed by first separating the mixture into its components through ...
A: Amino acids that take part in protein synthesis are of twenty different types. These twenty amino ac...
Q: Assume that a certain cell, the ratio products/reactants or Keq 560.6 (Keq dimensionless) reaction G...
A: A reversible reaction is one that can go both forward and backward. When the rate of the forward rea...
After Drosophila DNA has been treated with a restriction
enzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun”
technique, every DNA sequence of Drosophila in a library
can be recovered.
a. How would you identify a clone that contains DNA
encoding the protein actin, whose amino acid sequence
is known?
b. How would you identify a clone encoding a specific
tRNA
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- After Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun” technique, every DNA sequence of Drosophila in a library can be recovered.a. How would you identify a clone that contains DNA encoding the protein actin, whose amino acid sequence is known?b. How would you identify a clone encoding a specific tRNA?To identify the following types of genetic occurrences, would acomputer program use sequence recognition, pattern recognition,or both?A. Whether a segment of Drosophila DNA contains a P element(which is a specific type of transposable element)B. Whether a segment of DNA contains a stop codonC. In a comparison of two DNA segments, whether there is aninversion in one segment compared with the other segmentD. Whether a long segment of bacterial DNA contains one ormore genesA plasmid that is both ampicillin and tetracyclineresistant is cleaved with PstI, which cleaves within theampicillin resistance gene. The cut plasmid is ligated withPstI-digested Drosophila DNA to prepare a genomic library,and the mixture is used to transform E. coli K12. Question: Which antibiotic should be added to the mediumto select cells that have incorporated a plasmid?
- You would like to add a nuclear localization sequence (NLS) of Lys-Lys-Lys-Arg-Lys to a protein that is usually found in the cytoplasm of a yeast cell. To accomplish this, you introduce the nucleotide sequence encoding the NLS into the gene that encodes the cytoplasmic protein of interest. a. What is the size of the nucleotide insert that will encode the NLS? Briefly explain. 5' 3' b. Below is a diagram of the gene encoding the cytoplasmic protein of interest in the yeast genome. If your goal is to put the NLS at the carboxyl (C) terminus of the protein, at which location (A-E) should the NLS be inserted? Briefly explain. A TATAA ATATT promoter +1 B ATG TAC D TAA ATT stop codon E 3' 5'A plasmid that is both ampicillin and tetracyclineresistant is cleaved with PstI, which cleaves within theampicillin resistance gene. The cut plasmid is ligated withPstI-digested Drosophila DNA to prepare a genomic library,and the mixture is used to transform E. coli K12. Question: If recombinant cells were plated on medium containingampicillin or tetracycline and medium withboth antibiotics, on which plates would you expectto see growth of bacteria containing plasmids withDrosophila DNA inserts?After characterizing the DNA composition of various cats, you identify a protein-coding gene in tigers called stripes and wish to study the structure of the protein product STRIPES. This requires that you purify recombinant ridges from E. coli. First, the stripes gene must be amplified by PCR and then inserted into an appropriate plasmid for bacterial expression. Such a plasmid is diagrammed below. ori CAP Binding Site من Promoter MCS The restriction sites for Aatll and Kpnl are: Aatll 5'-GACGTC-3' Kpnl = 5'-GGTACC-3' Laco (Operator) -Kpnl Aatll The coding strand for the stripes gene is shown below, with start and stop codons in bold. 5'-ATGCAACAGTAGCTGAAGCCCAGTGACACCATCGAAAATGTGAAGGCCAAGATGAGGCTCATCTTTGCAGGCAAGCAGCTG GAAGATGGCCGTACTCTTTCTGACTATGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTGACCGGCAAGACCAATGT GAAGGCCAAGATCCAGGATAAAGAAGGCATCCCTCCCGACCAGCAGAGGGCACTCTTTCTGACTACAACATCCAGAAGGAGTCG ACCCTGCACCTGGTCCTGCTGACCGGCAAGACCATCACTCTGGAGGTGGAGCCCAGTGACACCATCGAAAATCCCGACCAGCAG…
- STEP BY STEP Exaplanation would be appreciated so I can understand for upcomming exam. In humans, the COL1A1 locus codes for a collagen protein found in bone. A recessive COLA1 allele believed to reduce bone density and increase risk of fractures differs from the wild type allele by the presence a GT in the first intron of the gene. This mutation can be easily screened by PCR, using COL1A1-specific primers followed restriction enzyme digest of the product with MscI. The normal allele is denoted as G and the recessive allele as T. A recent study of 894 women found that 570 were GG, 291 were GT and 33 were TT. (Assume for this exercise that these values reflect both male and female values for the sampled population. What are the frequencies of each allele? What are the frequencies of each genotype? c. Is this locus in Hardy-Weinberg equilibrium? Use the table below to evaluate the significance of any deviation from H-W expectations.Arabidopsis thaliana has among the smallest genomes in higher plants, with a haploid genome size of about 100 Mb. If this genome is digested with BbvCl, a restriction enzyme which cuts at the sequence CCTCAGC GGAGTCG 1. approximately how many DNA fragments would be produced? Assume the DNA has a random sequence with equal amounts of each base.Transcriptome analysis involves two separate methodologies: gene expression and RNA seq analyses. The 10 items below are a scrambled listing of the steps used in the two procedures. Identify the steps involved in RNA seq from the list below. Use the numbers in the list to refer to each step. Once the steps for RNA seq have been identified, write the steps in the order in which they are performed during the experiment. (1) DNA sequencing (2) Allow for hybridization and wash excess cRNA. (3) Mix labeled cRNA with array chip. (4) PCR amplification (5) Measure fluorescence intensity to determine abundance of transcripts. (6) Add labeled cRNA at each microarray location. (7) Map cDNA sequences to the genome of the organism to determine identity and abundance of transcripts. (8) mRNA isolation from cells (9) Prepare fluorescently labeled cRNA probes (10) cDNA synthesis
- In generating mutations in a bacterial gene involved in antibiotic resistance, a number of point mutations are isolated that render the bacteria sensitive to the antibiotic. You would like to sequence the gene in order to characterize the mutations, but unfortunately, your lab partner just finished the last of the lab's supply of DNA polymerase. The only things at your disposal are materials for performing a western blot, allowing you to visualize the protein encoded by the gene. How would you identify which mutations are likely to be the result of a missense mutation, which are likely to be the result of a nonsense mutation, and which are likely to be the result of a frameshift mutation?A plasmid that is both ampicillin and tetracyclineresistant is cleaved with PstI, which cleaves within theampicillin resistance gene. The cut plasmid is ligated withPstI-digested Drosophila DNA to prepare a genomic library,and the mixture is used to transform E. coli K12. Question: How can you explain the presence of colonies thatare resistant to both antibiotics?The technique of fluorescence in situ hybridization (FISH) is described. This is another method for examining sequence complexity within a genome. In this method, a DNA sequence, such as a particular gene sequence, can be detected within an intact chromosome by using a DNA probe that is complementary to the sequence.For example, let’s consider the β-globin gene, which isfound on human chromosome 11. A probe complementary to theβ-globin gene binds to that gene and shows up as a brightly colored spot on human chromosome 11. In this way, researchers can detectwhere the β-globin gene is located within a set of chromosomes. Becausethe β-globin gene is unique and because human cells are diploid(i.e., have two copies of each chromosome), a FISH experimentshows two bright spots per cell; the probe binds to each copy ofchromosome 11. What would you expect to see if you used thefollowing types of probes?A. A probe complementary to the Alu sequenceB. A probe complementary to a tandem array near…