A researcher is interested in using the in vitro technique of bisulfite conversion to confirm the methylation status of a DNA sequence. A. In vitro Sodium bisulfite treatment of DNA results in what type of chemical reaction? i. Which bases are preferentially affected? B. What nucleotide change is expected immediately following sodium bisulfite treatment of the DNA? C. You analyze the following DNA sequence before bisulfite treatment and after bisulfite treatment followed by a 30-cycle PCR reaction. Based on sequence comparison, how many cytosines were unmethylated in the original DNA sequence? Briefly explain how you came to this conclusion. Before bisulfite treatment: After bisulfite treatment and a 30-cycle PCR reaction: 5' CGACGCGCGATTCATTCGATT 3' 5' TGACGCGTGATTTATTTGATT 3'

Q: please solve this with step-by-step calculations and explanations.

A: The following is a step-by-step solution to this problem:a. In order to determine the melting…

Q: A. A plasmid is shown with the locations of various restriction enzyme sites labeled. If you cut the…

A: if we cut the plasmid with XhoI and XbaI then we will get three fragments of following sizes  1000…

Q: On the gel shown below are four DNA samples. Samples A to C are taken from tissues of landslide…

A: The gel electrophoresis is used to separate the DNA fragments according to their sizes. The smaller…

Q: Question 19. You need to prepare sequencing libraries of two different DNA fragment sizes. One…

A: A sequencing library is a collection of DNA fragments that have been prepared for high-throughput…

Q: In gel electrophoresis, are the DNA fragments attracted to, or repelled from the negative pole of…

A: Electrophoresis is a process where charged particles move under the influence of the electric field.…

Q: What is the purpose of the ethidum bromide that you add to the gel? Why do you need to be careful…

A: Gel electrophoresis Gel electrophoresis, it is a technique by which one can separate and analyse the…

Q: (Practice Hint: Click on the right-hand column to choose a bar height. Click again to change the bar…

A: DNA is made up of four nitrogenous bases: adenine (A), thymine (T), guanine (G), and cytosine (C).…

Q: Briefly explain the rationales of adding Bisacridine A which can affect DNA stability in polymerase…

A: PCR is used to enhance genes associated with patients' DNA genetic disorders. It has practical uses…

Q: A. Avery, MacLeod and McCarty proved DNA is the genetic material. If you were to repeat their…

A: The DNA replication is heterocatalytic process by which a new DNA strand is synthesized on a old DNA…

Q: What was the function of each solution or step in the DNA purification protocol? The following…

A: Deoxyribonucleic acid extraction is the isolation and purification of DNA from sample using a…

Q: ndicate whether each of the following statements are true of depurination, deamination or pyrimidine…

A: DNA is a long polymer of nucleotide. A nucleotide is made ip of sugar, nitrogenous bases, and…

Q: The team would now like to establish the smallest possible deletion that would inactivate the…

A: Amino acid monomers form the building blocks of proteins. The arrangement of amino acids makes up a…

Q: What should be the first step in the protocol for the purification of DNA from any source (including…

A: DNA is a nucleic acid found in the nucleus of the eukaryotic cells. It acts as genetic material. DNA…

Q: Meselson and Stahl grew bacteria in medium containing heavy nitrogen. After many cell divisions, the…

A: From Meselson and Stahl's experiment we have known that DNA replication is semi-conservative.

Q: To relax a supercoiled DNA, you may use, Select one: O a. DNA topoisomerase I O b. DNA helicase O c.…

A: Ans:- (a) DNA topoisomerase I

Q: Scenario 1: DNA concentration? UV-Vis spectroscopy [Choose ] Homology Modeling Scenario 2: Does it…

A: Different techniques are used for determining different properties.

Q: There are various types of DNA-targeting drug, including DNA alkylating agents, DNA intercalators…

A: Mutations are DNA errors that occur during life. A mutation is defined as any alteration in the DNA…

Q: Match each statement with the best possible single answer from the list below. Terms may be used in…

A:

Q: Mutations caused by insertion of a DNA transposon are often genetically unstable, reverting to…

A: if a DNA transposon is inserted into DNA it causes mutations. these type of mutations are not…

Q: enzymes ECORI and HINDIII are called "compatible" enzymes. DNA cut with these enzymes can be ligated…

A: Restriction Endonucleases Restriction endonucleases or restriction enzymes are the enzymes that can…

Q: Pyrimidine dimers in DNA may be repaired by in E. coli cells. (select all correct answers) Select…

A: The most well-known DNA lesion involving a single DNA strand is pyrimidine dimer. It is an…

Q: Give typing answer with explanation and conclusion to all parts Maxim-Gilbert and Sanger Sequencing…

A: DNA sequencing is a technique that involves reading the order of the arrangement of DNA bases. Maxam…

Q: You used agarose gel electrophoresis to separate DNA fragments of different size and the experiment…

A: Agarose gel electrophoresis is a method to separate, identify and purify the DNA molecules.…

Q: Assume complete digestion of a single linear piece of DNA digested (cut) with EcoRI and Hindill.…

A: A plasmid is a single-stranded, circular DNA molecule that is different from the chromosomal DNA of…

Q: A geneticist is interested in determining the locations of methylated cytosines within a fragment of…

A: Sodium bisulfite (NaHSO3) is a potent deamination agent. It removes an amino group (-NH2) from…

Q: To terminate a reaction in which a restriction enzyme cleaves DNA, researchers often add high…

A: Restriction enzymes are endonucleases that identify and cleave at specific sequences within DNA.…

Q: DNA ladder Sample digested with EcoRI negative electrode 23- This is the result of gel…

A: Introduction Gel electrophoresis is a technique that uses size and charge to separate and analyse…

Bacterial Genomics

The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.

Transformation Experiment in Bacteria

In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.

Plasmids and Vectors

The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.