a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR =  3'UTR =

Q: There are dozens of common variations of the c-myc gene, which are associated with different types…

A: The mRNA is produced from the DNA by the transcription process and this mRNA is used for the protein…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: A). What is the amino acid sequence of the polypeptide produced from a eukaryotic gene that has the…

A: Transcription  The process on making mRNA from DNA which further get translated into polypeptide…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: A. If the image below is an electron micrograph showing the result of an experiment in which DNA and…

A: Replication is a process of providing duplication of original data DNA Replication is a process of…

Q: Which of the following represents the sequence of an RNA transcript for which the template strand of…

A: The deoxyribonucleic acid (DNA) is the nucleotide sequence that stores the genetic information of an…

Q: Transcribe and translate the following DNA sequence (nontemplate strand);…

A: The gene is expressed into protein by the transcription and translation step.

Q: The sequence below (A) was read from the autoradiogram (B). (A) 5'…

A: Note: since you have asked multiple unrelated questions, as per the honor code we are answering the…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: 5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP…

A: Transcription is the process of formation of mRNA from DNA template strands by an enzyme called RNA…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: b. The diagram below is of a short stretch of prokaryotic chromosomal DNA in the process of…

A: Replication It is defined as the process in which the DNA duplicates into another copy which is…

Q: B. Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a…

A: A silent mutation is a type of mutation that occurs in DNA where a single nucleotide is changed, but…

Q: following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA…

A: A) The output from the given nucleotide sequence is RYIF which is Arginine>Tyrosine>…

Q: Be sure to answer all parts. Consider the following mRNA sequence: 5'-GCU AGG CGA-3'. a. What amino…

A: Translation is the process in which the m rna is converted into a polypeptide chain of amino acids…

Q: Examine Figure 16.2b. Why do you think the motif of the DNA-binding protein shown is called a…

A: Deoxyribonucleic acid (DNA) binding proteins are proteins that attach to single stranded or double…

Q: Describe the d=features of the following DNA-binding domains and how they interact with DNA.…

A: DNA-binding domain abbreviated as DBD is a protein domain that is folded independently and contains…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: 5’ GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG 3'  From above sequence…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: .  Locate the -10 region hexanucleotide sequence in the following coding strand of DNA.  Indicate…

A: Transcription is a process through which the template strand of the DNA transcribes into mRNA in the…

Q: . a. What are all the transversions that can be made starting with the codon CGG?b. Which of these…

A: In molecular biology, a point mutation in DNA occurs when a single (two ring) purine (A or G) is…

Q: Use the Genetic Code below to help you answer the following questions.  The nucleotide sequence of…

A: Mutation is the change in the genetic makeup of the organism, mutation particularly in the genes can…