Answered: . Locate the -10 region hexanucleotide…

. Locate the -10 region hexanucleotide sequence in the following coding strand of DNA. Indicate the region of the RNA polymerase initiation site. AATTGGGATCCCTATAATGCGCCTACGTTGAGACGAGTGGACGC

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Related questions

Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: The template strand is a DNA strand that functions as a template for the synthesis of complementary…

Q: and these protect the strands and prevent the separated DNA strands from reannealling at Single…

A: DNA replication is the process by which a molecule of DNA is duplicated. In this, a dsDNA molecule…

Q: Indicate 2 ways which ensure DNA fidelity when carrying the message to protein which occur in the…

A: DNA fidelity refers to the ability of the DNA polymerase to avoid or rectify the errors made in the…

Q: Provide the complementary strand and the RNA transcription product for the following DNA template…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Examine the following sequence of DNA 3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG –…

A: The central dogma is a metabolic process where the DNA acts as genetic material and transcripted…

Q: The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA…

A: The RNA sequence would be same as coding strand (except thiamine is replaced by uracil) and opposite…

Q: 10. In the diagram below, Transcribe the two new complementary strands of DNA. ,ΑTIGCCAAGT…

A: According to the question, we have seen a diagram, where we have to transcribe the two new…

Q: Briefly describe two of the tree functions of RNA polymerase

A: RNA polymerase is a catalytic enzyme that is liable for duplicating a DNA succession into a RNA…

Q: Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: Transcription is the process by which RNA polymerase read out DNA and make m-RNA then mRNA is…

Q: E 64 In the figure shown below, which of the DNA strands is the template strand, upper or lower?…

A: Ans- The template strand of the DNA serves as a template for synthesis of a complementary RNA…

Q: ble opposite shows the standard (coding strand) DNA codes for the 20 amino acids involved in protein…

A: Introduction :- Gene expression is the process of formation of response or functional part through a…

Q: table opposite shows the standard (coding strand et codes for the 20 amino acids involved in protein…

A: DNA is a nucleic acid.

Q: If the sequence of the coding strand in a transcription unit is written as follows: 5'-…

A: In that question we have to write down the sequence of mRNA.

Q: Explain the synthesis of the leading and lagging strands during DNA replication and identify the…

A: The enzyme DNA polymerase with an RNA primer can synthesize new strands in the 5' to 3' direction.…

Q: List at least five properties that DNA polymerases and RNA polymerases have in common. List at least…

A: The polymerase is an enzyme that synthesizes the long chains of nucleic acids or polymers. The DNA…

Q: 9The table opposite shows the triplet codes for the 20 amino acids involved in protein synther A…

A: Codons are three DNA sequence triplets that code for specific amino acids and there are a total of…

Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…

A: The genetic code includes the information on DNA for the protein made from RNA, which is called gene…

Q: Explain Leading-strand and lagging-strand DNA synthesis.

A: During the process of normal replication 1. As compared to leading strand synthesis, lagging strand…

Q: 5’GCTATAAAGCGTATCGCGTCATA 3

A: Complementary mRNA 5’GCT ATA AAG CGT ATC GCG TCA TA '3 3'CGA UAU UUC GCA UAG CGC AGU AU '5

Q: Give

A: Introduction:- The central dogma of biological sciences explains how genetic information is…

Q: The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat…

A: WT replication without slippage:

Q: . The table opposite shows the standard (coding strand) DNA riplet codes for the 20 amino acids…

A: Introduction The process of synthesis of proteins occurs in two steps which are transcription and…

Q: Transcription is initiated when: a. initiation factors assemble ribosomal subunits, mRNA, and…

A: Transcription: It is Initial copying of the DNA strand with RNA Polymerase to make RNA. Before the…

Q: B. Transcript and Translate the following: DNA-TACTGATCGACCCCCATA ATGAAAATCGGGCCC MRNA- AA- DNA -…

A: Coding DNA strand and mRNA has same sequence except T in DNA and U in RNA mRNA - Complementary to…

Q: Explain the molecular mechanism of DNA polymerization by DNA polymerase and explain why DNA…

A: DNA replication is necessary to ensure genetic continuity and genome inheritance from parents to…

Q: 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’…

A: The process of copying the information in a strand of DNA to produce an mRNA is called…

Q: Use the (non-template) DNA strand below to determine which is the promoter/sigma binding region:…

A: Introduction: A promoter is a DNA sequence to which proteins bind to start transcription of a single…

Q: Determine each of the following items using the hnRNA nucleotide sequence (enter the answer using…

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: State the DNA sequence that encodes the anticodon that recognizes the codon AAG, with 5’ and 3’ ends…

A: An anticodon is a trinucleotide sequence that is complementary to the corresponding codon in a…

Q: Describe the DNA replication process, including its initiation and the events that occur at the…

A: Watson and Crick discovered that DNA was a two-stranded double helix which provided an idea of how…

Q: Identify the sites of lagging strand synthesis. Select all that are true. B

A: DNA replication of the double-stranded DNA occurs simultaneously at both strands. The replication…

Q: In which strand is the promoter? 5' TCATGAGATA GCCATGCATA TCTAGTATGT AGGCATCTGA GTTTATATCT CA 3' 3'…

A: Phosphodiester linkages connect DNA strands, which are polymers or chains of deoxynucleoside…

Q: Given the following non-coding strand of DNA nucleotides:G T T C C C T T T G G A A C C T G G Write…

A: Nucleic acids are the essential macro molecules that carry and transmit genetic information in the…

Q: In the DNA segment 5'-ATGAGGCATGAGACG-3' (coding strand) 3'-TACTCCGTACTCTGC-5' (template strand)…

A: A DNA segment is generally a genomic feature recognized by anonymous DNA probes. Symbols for such…

Q: 5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’ Label the sense and antisense strands…

A: DNA is ladder like , helical structure which have ability to form its own copies via DNA replication…

Q: Describe in detail how the leading and lagging strands are synthesized concurrently during DNA…

A: A new strand of DNA is always synthesized in the 5' to 3' direction by the DNA polymerase enzyme.…

Q: b. Now do this AGAIN assuming that the DNA and RNA templates are read right to left. DNA strand DNA…

A: The mRNA is produced from the DNA template by the transcription process and then mRNA is used for…

Q: Explain semi-conservative modelmof DNA replication b) discuss initiation in DNA replication and…

A: DNA replication is the process in which the copies of DNA is made by the action of several enzymes…

Q: Match Column A with Column B. pulls a portion of the DNA strands apart from each A. 3rd event other,…

A: The process of transcribing a piece of DNA into RNA is known as transcription. Messenger RNA is made…

Q: Illustrate the process of transcription by providing the correct bases for mRNA strand given the DNA…

A: Transcription is the process where the genetic information on the DNA strand is transferred into an…

Q: Determine each of the following items using the hnRNA nucleotide sequence (enter the answer using…

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: an adult with a history of tanning has his genome sequenced. The beginning of a protein coding…

A: Mutations are the changes in the genetic sequence that may result in genotypic or phenotypic…

Q: Define and indicate the significance of primer RNA during DNA replication

A: DNA is a polymer of nucleotides.

Q: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA…

A: The central dogma of life involves three processes. They are: Replication: In this process, copies…

Q: The template strand (i.e.: the strand that is transcribed into RNA, which is usually represented “at…

A: Introduction: DNA is the genetic material that transfers from one to another except for some viruses…

Q: 4. Draw and label the Transcription process. 5. Draw and label the Translation process.

A: Transcription is the process in which RNA is made from DNA, while translation is the process in…

Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: Translation is process in which proteins are synthesized.

Q: Describe the processes of transcription and translation from DNA to polypeptide chain

A: Polypeptides are amino acid chains joined together by peptide bonds. Amino terminal or N terminal…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

. Locate the -10 region hexanucleotide sequence in the following coding strand of DNA. Indicate the region of the RNA polymerase initiation site.

AATTGGGATCCCTATAATGCGCCTACGTTGAGACGAGTGGACGC

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.
Give the mRNA and amino acid sequence from this DNA strand: CCATTAACCTTACTGCTGGCTAAATTCGTTGCT
Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by indicating template and non template strands.(SLO1)5’-ACGGCATGCATGGTTTAAAAGGGGCCCAAAA-3’3’-TGCCGTACGTACCAAATTTTCCCCGGGTTTT-5’
What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'
Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT
a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
Which of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5'-3'. OA. AAGAUCGUCGAUCGGUCAUG OB. AAGATCGTCGATCGG TCATG OC. GTACTGGC TAGCTGC TAGAA OD. GUACUGGCUAGCUGCUAGAA
Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acid
Provide the complementary strand and the RNA transcription product for the following DNA template segment:5'-AGGGGCCGTTATCGTT-3'
This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.
3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.
From standpoint of replication and transcription, explain how RNA polymerase is allowed to incorporate the first nucleotide whereas DNA polymerase needs a primer. Explain how this difference impacts the process of replication and transcription.