Please answer all parts to #2 **Transcription of DNA Sequence Analysis for Educational Website**---**DNA Sequence Analysis**2. The starting region of a DNA gene is represented by the sequence: ``` 5’ GCATATGGCTTTTCCGCCGCGGCGGACGGCTGCGC 3’ ```**Questions:**1. **Complementary Strand Sequence:** - Write the sequence of the complementary (template) strand in the 5’ to 3’ direction.2. **mRNA Sequence:** - If the template strand is used for transcription, what is the sequence of the resulting mRNA?3. **First Codon Identification:** - From the mRNA sequence, identify the first codon involved in protein synthesis.4. **Polypeptide Sequence:** - If the mRNA is used for translation, determine the polypeptide sequence starting from the first codon.5. **Mutation Analysis:** - If one nucleotide is mutated, resulting in the sequence: ``` 5’ GCATATGGCTTTTCGCCGCGGCGGACGGCTGCGC 3’ ``` - What is the polypeptide sequence? Explain the type of mutation this is.**Note:**- Such exercises help students understand DNA transcription and translation processes, identify codons, and interpret the effects of mutations on genetic sequences.

As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic information is in the form of a genetic code. The genetic information is copied onto an mRNA by a DNA-dependent RNA polymerase The process is called transcription. The genetic code is a nucleotide triplet called codons. There are a total of 64 codons out of which only 61 code for amino acids while the 3 that are left do not code for any protein and are called stop codons (because protein synthesis stops when RNA polymerase reaches the stop codonsThe two strands of DNA are complementary so the template strand would be complementary to the DNA strand given. As per Watson-Crick pairing, Adenine pairs with Thymine and Guanine pairs with Cytosine. The mRNA will be complementary to the template strand and Uracil will replace Thymine in mRNA. Mutation means a change in nucleotide sequence. Since a single nucleotide change in mRNA results in a change of a single residue in the polypeptide, the mutation is called single base pair point mutation or simply a point mutation

Science

Biochemistry

2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC 3'. 1) Please write down the sequence of the complementary strand (the template strand) in the 5' to 3' direction. 2) If the template strand is used as a template for transcription, what is the sequence of the resulting mRNA? 3) From this sequence, please figure out the first codon in protein synthesis. 4) If the mRNA is used for translation, please figure out the polypeptide sequence (starting from the first codon). 5) If one nucleotide is mutated, and resulting sequence is: 5' GCATATGGCTTTTCGGCCGCGGCGACGGCTGCG C 3'. What is the polypeptide sequence? Please explain what type of mutation this is.

2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC 3'. 1) Please write down the sequence of the complementary strand (the template strand) in the 5' to 3' direction. 2) If the template strand is used as a template for transcription, what is the sequence of the resulting mRNA? 3) From this sequence, please figure out the first codon in protein synthesis. 4) If the mRNA is used for translation, please figure out the polypeptide sequence (starting from the first codon). 5) If one nucleotide is mutated, and resulting sequence is: 5' GCATATGGCTTTTCGGCCGCGGCGACGGCTGCG C 3'. What is the polypeptide sequence? Please explain what type of mutation this is.

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

still waiting on my answers to my questions
Please answer fast A 26-year-old male was returning from a neighborhood store with a six-pack of beer. He attempted to run across a busy street but was struck by a car. He was fully conscious at the scene, complaining of pain in his abdomen and left leg. Examination by paramedics revealed an open fracture of the left tibia with moderate bleeding, left upper quadrant pain with rebound tenderness, and a fast, weak pulse. The leg was immobilized, oxygen was administered, an IV started, and he was transported to the Trauma Center, approximately 10 minutes away. About 3 minutes before arriving at the Trauma Center, he suffered cardiopulmonary arrest from which he could not be resuscitated, despite vigorous advanced life support. At autopsy, his stomach was found to be full of beer, along with 4 whole wieners (without any teeth marks!). His spleen, which is normally about the size of the patient’s fist, was grossly enlarged: it measured from just under the diaphragm to the level of the…
Hello, can you please answer the above question in greater detail? Thank you
Please answer asap and type your answer and do not copy from anywhere please
please help
I need answer within 5 minutes please with my best wishes
Hi can you help me with this practice homework. I’m a bit lost. If I can also receive some explanation I’ll be glad thank you.
Please answer asap and type your answer and do not copy from anywhere please what membranes will the needle pass through to reach CSF?
can you answer in 5 simple statement please? it is hard for me to understand like that
Please help me asap
What hormonal changes do take place in humans when they try to reproduce? This assignment needs to be submitted urgently. Please help.
answers for selected box in grey