Please answer all parts to #2 **Transcription of DNA Sequence Analysis for Educational Website**---**DNA Sequence Analysis**2. The starting region of a DNA gene is represented by the sequence: ``` 5’ GCATATGGCTTTTCCGCCGCGGCGGACGGCTGCGC 3’ ```**Questions:**1. **Complementary Strand Sequence:** - Write the sequence of the complementary (template) strand in the 5’ to 3’ direction.2. **mRNA Sequence:** - If the template strand is used for transcription, what is the sequence of the resulting mRNA?3. **First Codon Identification:** - From the mRNA sequence, identify the first codon involved in protein synthesis.4. **Polypeptide Sequence:** - If the mRNA is used for translation, determine the polypeptide sequence starting from the first codon.5. **Mutation Analysis:** - If one nucleotide is mutated, resulting in the sequence: ``` 5’ GCATATGGCTTTTCGCCGCGGCGGACGGCTGCGC 3’ ``` - What is the polypeptide sequence? Explain the type of mutation this is.**Note:**- Such exercises help students understand DNA transcription and translation processes, identify codons, and interpret the effects of mutations on genetic sequences.

As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic information is in the form of a genetic code. The genetic information is copied onto an mRNA by a DNA-dependent RNA polymerase The process is called transcription. The genetic code is a nucleotide triplet called codons. There are a total of 64 codons out of which only 61 code for amino acids while the 3 that are left do not code for any protein and are called stop codons (because protein synthesis stops when RNA polymerase reaches the stop codonsThe two strands of DNA are complementary so the template strand would be complementary to the DNA strand given. As per Watson-Crick pairing, Adenine pairs with Thymine and Guanine pairs with Cytosine. The mRNA will be complementary to the template strand and Uracil will replace Thymine in mRNA. Mutation means a change in nucleotide sequence. Since a single nucleotide change in mRNA results in a change of a single residue in the polypeptide, the mutation is called single base pair point mutation or simply a point mutation

Science

Biochemistry

2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC 3'. 1) Please write down the sequence of the complementary strand (the template strand) in the 5' to 3' direction. 2) If the template strand is used as a template for transcription, what is the sequence of the resulting mRNA? 3) From this sequence, please figure out the first codon in protein synthesis. 4) If the mRNA is used for translation, please figure out the polypeptide sequence (starting from the first codon). 5) If one nucleotide is mutated, and resulting sequence is: 5' GCATATGGCTTTTCGGCCGCGGCGACGGCTGCG C 3'. What is the polypeptide sequence? Please explain what type of mutation this is.

2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC 3'. 1) Please write down the sequence of the complementary strand (the template strand) in the 5' to 3' direction. 2) If the template strand is used as a template for transcription, what is the sequence of the resulting mRNA? 3) From this sequence, please figure out the first codon in protein synthesis. 4) If the mRNA is used for translation, please figure out the polypeptide sequence (starting from the first codon). 5) If one nucleotide is mutated, and resulting sequence is: 5' GCATATGGCTTTTCGGCCGCGGCGACGGCTGCG C 3'. What is the polypeptide sequence? Please explain what type of mutation this is.

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: are you sure? i got 149

A: PCR means polymerase change reaction in which the main enzyme DNA polymerase amplifies a given DNA…

Q: If a patient or loved one has made it very clear that they do not want any extraordinary life saving…

A: DNR stands for "Do Not Resuscitate. " it's a medical order that denotes a patient's decision to…

Q: You are doing a genetics experiment with the fruit fly. In the "F1" generation, you cross two…

A: The alleles are the alternative forms of a gene that are located on the same locas of a homologous…

Q: Put the molecules in the right category for Cellular Respiration Reactants (What goes IN to the…

A: This is the reaction of Cellular Respiration where oxygen is combined with the food molecules by the…

Q: Your answer is incorrect please revise. Thanks

A: Bacterial infections can be harmful to the body as they can cause a range of symptoms and…

Q: 3. Indicate whether the following statements are true or false. If false, rewrite it to make as…

A: The human body contain different systems. All of the systems functions in a coordinate manner to…

Q: Please advise

A: Appositional growth is the expansion of the cartilage matrix from within. It includes…

Q: What education should you provide to Fred (Male) about his new medication Captopril? (dot point but…

A: Captopril is the medication belonging yo the class of drugs called ACE inhibitors , these drugs are…

Q: DIVIDING WORDS EXERCISE Separate these words into their component parts (prefix, combining form,…

A: Medical terminologies help in easier understanding of the word. It gives the origin, the components,…

Q: Can you please answer number 7 and all of the sub parts

A: Glycolysis is a process of breaking down one molecule of glucose into two molecules of pyruvate in…

Q: Please help, i need this to study, i dont get it, make the answer clear

A: muscle contraction is basically the shortening of sarcomere , these are the units of myofibrils with…

Q: Please answer fill in the blank in the picture. Thank uou

A: Eye: The eye is a hollow, spherical structure. They are located in eye orbits formed in skull…

Q: Would you like to eat? Yes, l'd love. This (10 sentence grammatically is True .a False .b

A: Yes this sentence is right grammatically. There is no error in this sentence but it can be more…

Q: are you sure? i got a different answer

A: Skeletal muscles are striped and voluantary muscles. On the other hand, cardiac muscles are the…

Q: There is more than one right answer

A: During exercise, physical activity increases and different voluntary movements are produced.…

Q: are you sure? i thought the answer was b not c

A: The primary motor cortex, also known as M1 or the precentral gyrus, is a region of the cerebral…

Question

Please answer all parts to #2

**Transcription of DNA Sequence Analysis for Educational Website**

---

**DNA Sequence Analysis**

2. The starting region of a DNA gene is represented by the sequence:
```
5’ GCATATGGCTTTTCCGCCGCGGCGGACGGCTGCGC 3’
```

**Questions:**

1. **Complementary Strand Sequence:**
- Write the sequence of the complementary (template) strand in the 5’ to 3’ direction.

2. **mRNA Sequence:**
- If the template strand is used for transcription, what is the sequence of the resulting mRNA?

3. **First Codon Identification:**
- From the mRNA sequence, identify the first codon involved in protein synthesis.

4. **Polypeptide Sequence:**
- If the mRNA is used for translation, determine the polypeptide sequence starting from the first codon.

5. **Mutation Analysis:**
- If one nucleotide is mutated, resulting in the sequence:
```
5’ GCATATGGCTTTTCGCCGCGGCGGACGGCTGCGC 3’
```
- What is the polypeptide sequence? Explain the type of mutation this is.

**Note:**
- Such exercises help students understand DNA transcription and translation processes, identify codons, and interpret the effects of mutations on genetic sequences.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Introduction

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

still waiting on my answers to my questions
Please answer fast A 26-year-old male was returning from a neighborhood store with a six-pack of beer. He attempted to run across a busy street but was struck by a car. He was fully conscious at the scene, complaining of pain in his abdomen and left leg. Examination by paramedics revealed an open fracture of the left tibia with moderate bleeding, left upper quadrant pain with rebound tenderness, and a fast, weak pulse. The leg was immobilized, oxygen was administered, an IV started, and he was transported to the Trauma Center, approximately 10 minutes away. About 3 minutes before arriving at the Trauma Center, he suffered cardiopulmonary arrest from which he could not be resuscitated, despite vigorous advanced life support. At autopsy, his stomach was found to be full of beer, along with 4 whole wieners (without any teeth marks!). His spleen, which is normally about the size of the patient’s fist, was grossly enlarged: it measured from just under the diaphragm to the level of the…
Hello, can you please answer the above question in greater detail? Thank you
please help
I need answer within 5 minutes please with my best wishes
Hi can you help me with this practice homework. I’m a bit lost. If I can also receive some explanation I’ll be glad thank you.
can you answer in 5 simple statement please? it is hard for me to understand like that
What hormonal changes do take place in humans when they try to reproduce? This assignment needs to be submitted urgently. Please help.
answers for selected box in grey
Can you please answer the last four in complete sentence, not graded, thanks
i need the answer quickly
I only need the correct answer fast please