The following sequence is a double stranded DNA. 5'ATTTGACAATGCGTTAGGCATGACTATGTATAATGCATGCCACATACT... 3' 3'TAAACTGTTACGCAATCCGTACTGATACATATTACGTACGGTGTATGA…5' -35 -10 +1 Where does RNA polymerase initially binds?
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
The following sequence is a double stranded DNA.
5'ATTTGACAATGCGTTAGGCATGACTATGTATAATGCATGCCACATACT... 3'
3'TAAACTGTTACGCAATCCGTACTGATACATATTACGTACGGTGTATGA…5'
-35 -10 +1
Where does RNA polymerase initially binds?
The promoter region is a crucial segment of DNA located upstream (in the 5' direction) of a gene that serves as the initiation site for transcription. It plays a fundamental role in regulating gene expression by providing a binding site for RNA polymerase and other transcription factors.
Step by step
Solved in 3 steps
