DNA Leading strand: 5' AAA ATA | CGC TTT|TTA ATT| AAC CCC GGG 3' A | B| C I D Exons: A, C, D Introns: B 1. What is the structure of hnRNA transcribed from this template? 2. What is the structure of the MRNA obtained by splicing the hnRNA? 3. What will be the polypeptide sequence to be synthesized using this mRNA?
Q: Provide a simple sketch of the covalent intermediate likely to form between active site serine…
A: DPCC: Diphenylcarbamyl chloride has two phenyl group attached to carbamyl chloride. Serine Protease:…
Q: The reaction catalyzed by glyceraldehyde 3-phosphate dehydrogenase involves two "sub-reactions", one…
A: A mole of NAD is reduced to NADH by glyceraldehyde phosphate dehydrogenase, resulting in…
Q: well-conserved regions in multiple sequence aligmements: a. are areas of structural importance b.…
A: Multiple Sequence Alignment (MSA) is the alignment of three or more comparable length biological…
Q: 1. How is PKD inherited? What gene is responsible for the expression of PK enzyme ?
A: Pyruvate kinase deficiency is an inherited lack of the pyruvate kinase, that gets used by red blood…
Q: Sample Results Remarks Glycine A Methionine B Egg albumin
A: Lead sulphide test is a specific test for the detection of sulphur containing aminoacid like cystein…
Q: 4. Synthesis of basic corticosteroids. Steroid: A. Testosterone. B. Aldosterone. C. Pregnenolone. D.…
A: Introduction: Corticosteroids are steroid hormones that are synthesized in the adrenal cortex. It is…
Q: Why does picric acid and tannic acid are used to treat burn?
A: PICRIC ACID : Picric acid is an organic compound containing IUPAC name as TNP (2,4,6 tri nitro…
Q: Retroviruses, like the HIV, contain an enzyme called reverse transcriptase. Explain the flow of…
A: In the last 40 years, scientific understanding of retroviruses has increased dramatically. The word…
Q: n the discovery of new drugs, the chemical and physical properties of a molecule are very important…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…
Q: Which of the following is not a similarity between prokaryotic initiation and eukaryotic initiation?…
A: Translation is a process of Synthesis of polypeptide chain from mRNA template by using Ribosomes. It…
Q: What is the final enzyme used in the biosynthesis of stearate (C18:0)? A. Elongase B.Beta-Ketoacyl-…
A: Fatty acid biosynthesis occurs in the cytoplasm of the cell. Fatty acids are the long-chain…
Q: Draw a Lineweaver-Burk plot for these data. Put both sets of data on the one graph, use a different…
A: If an enzyme follows Michaelis-Menten Kinetics, a plot of the reciprocal of the reaction velocity…
Q: Question 4 Match the following descriptions to the given choices v Synthesized from a steroid…
A: A vitamin is an organic molecule which is an essential micronutrient for organism and are needed…
Q: Estimate the charge on albumin in blood (pH 7.4). The sequence composition of albumin iş listed…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Three [BIOMOLECULES] Instructions; — Answer the questions properly. — Do not copy in Google or…
A: Fatty acids are hydrocarbon chains with a carboxylic acid group. Fatty acids are classified as…
Q: Explain which of the following substances ATP, CoA-SH, FAD and NAD+ have the subunits in their…
A: Four substances ATP, CoA-AH, FAD and NAD+ are given. Here, we have to identify the subunits in their…
Q: CH,O-P-o C=O 0. CH,O-P-o- CH-OH C=O Ó. HO-C-H H-C-OH H-C-OH O C-H of ČH;O-P-0- H-C-OH O CH;0-P-O 0.
A: Glycolysis is the metabolic pathway that converts glucose into pyruvic acid.
Q: Compare and contrast DNA replication and PCR.
A: Dna replication is the process of Synthesis of new daughter dna molecules or duplication of parent…
Q: List the microbial targets of disinfecting chemicals, how that affects the microbe, and provide one…
A: The Environmental Protection Agency (EPA) registered disinfecting agents as antimicrobial…
Q: Q1. (a) Describe and illustrate each of the following immunoprecipitation techniques (i)…
A: a) Immunoprecipitation (IP) refers to the small-scale affinity purification of antigens with the…
Q: The polypeptide chains in insulin are held together by hydrogen bonds Group of answer choices True…
A: Insulin is a protein made up of two polypeptide chains designated as A (21 amino acids residues) and…
Q: Outline 3 properties of proteins that can be used in bioseparations and explain how you could…
A: Proteins are macromolecules that are made up of Amino acids. They can be classified as globular…
Q: Explain what Hepatocyte hopping is
A: Introduction: The liver is the modified exocrine gland and liver cells are made up of hepatocytes.…
Q: 4. During a lunch at a McDonald's outlet, an office employee received about 350 g of carbohydrates…
A: for you. If you want a specific question to be answered then please specify the question number or…
Q: 1. What are the major functions of lipids?
A: Introduction: Lipids are a heterogeneous group of biological compounds which includes fats, oils,…
Q: How does NH4SO4 affect water structure? What does this have to do with protein solubility? I thought…
A: The solubility of a protein in solution depends on nature of the protein and the concentration of…
Q: Which statement regarding glycolysis is TRUE? Group of answer choices Both substrate-level…
A: Glycolysis is the process of oxidation of one mole of glucose into two moles of pyruvate. It occurs…
Q: Given Tagatose, Briefly explain its expected reaction (based on their structural formula) to the…
A: Tagatose is ketohexose i.e. it has 6 carbons and is a ketose sugar.
Q: Describe the reaction and the products that would occur if transketolase acred upon a pentose aldose…
A: Transketolase is an enzyme of pentose phosphate pathway which accept two carbon from pentose ketose…
Q: For you, what is the contribution around 18-1900 of golden era in biochemistry? Explain
A: Introduction: The term biochemistry refers to the study of the chemistry of living things including…
Q: During the treatment of hyperlipidemia, what is the metabolism of lipoproteins; and the mechanism of…
A: Hyperlipidemia refers to a high-level blood lipids like cholesterol (non-HDL cholesterol and LDL…
Q: H o-H H Н-С-н `cc- .と、 H toluene phenol エ エ 工王 \\
A: Retention factor The amount which each component of a mixture travels can be easily quantified using…
Q: Which of the following is the process where there is transfer of phosphate group to produce ATP or…
A: ATP and GTP are nucleoside triphosphates that are important for cellular function. They are produced…
Q: When human hemoglobin undergoes a mutation, the mutant protein usually does not replace all of the…
A: The cytosol of red blood cells contains the oxygen-carrying globular protein hemoglobin, which is…
Q: 8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach…
A: Hemoglobin is a conjugated protein with four polypeptide chains. It contains two identical alpha and…
Q: 1 Suppose that you have 1ml of a buffer solution with a pH of 6.8 and you add 1ml of 2% starch…
A: Salivary amylase is an enzyme that works on catalytic digestion of starch. Salivary amylase…
Q: How many cycles of β oxidation are necessary to completely catabolize palmitic acid ( CH3(CH2)14COOH…
A: Introduction: Fats are important sources of energy for our body as 1g of fat gives 9kcal of energy.…
Q: Please explain what happened in the reaction. How did H2SO4 and 3H2O reacted with the glucose?
A: Carbohydrates are polyhydroxy aldehydes or ketones or compounds that yield them on hydrolysis.…
Q: Which types of ion exchange resin will the the peptide Ala-Glu-lle-Lys- Leu-Asp-Gly bind to at the…
A: Ion exchange chromatography consists of column with loaded resin that can exchange oppositely…
Q: Which of the following is NOT true regarding nicotine? a. its psychoactive effects include…
A: Nicotine is a toxic substance present in tobacco. Nicotine is addictive and is hard to quit. It…
Q: A newly developed qPCR has an efficiency of 75%, and each cycle is pretty consistent. In this qPCR,…
A: In general, qPCR is beneficial for determining the actual value of a PCR product present at a given…
Q: Which mayonnaise is thicker? Mixing oil to the mixture gradually or mixing all the ingredients in?…
A: Mayonnaise is a condiment used in burgers, salads, and sandwiches. Mayonnaise is considered as a…
Q: Please explain how did this reaction happened.
A: Molisch's test is a qualitative test used to detect the presence of carbohydrate in a sample. In the…
Q: How many molecules of water are produced by the electron transport chain during the complete aerobic…
A: Stearate is saturated fatty acids. It is metabolized by beta oxidation in the cytoplasm. It releases…
Q: Progesterone is mainly responsible for the development of sexual characteristics and function O True…
A: Progesterone is a C-21 steroid hormone. Cholesterol is the precursor for progesterone. Progesterone…
Q: Answer the following multiple-choice questions and EXPLAIN in 3-5 sentences why you chose that…
A: Enzyme is basically biocatalyst that increase the rate of chemical reaction without itself being…
Q: Match the following descriptions to the given choices. A. Aldosterone The first molecule in the…
A: 1. The first molecule in the biosynthesis of steroids that contain the…
Q: The "D" in DNA stands for which of the following?
A: DNA : Chemical name for molecule which carries genetic instructions in the living organisms.
Q: Visceral fat loss is often associated with increased insulin sensitivity. Assuming that with the…
A: D. -10.6
Q: sunganegy Two dialysis membranes each containing a methylene blue solution were placed in beakers of…
A: In dialysis, colloids are separated from dissolved ions or molecules of small dimensions or…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this geneEukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.
- 1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the MRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the mRNA sequence be? Explain your answer and label all strands. A. First letter of codon…1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the mRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the MRNA sequence be? Explain your answer and label all strands. 歐歐队 相阳阳一即即的 9 First letter…8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the MRNA. Write the corresponding MRNA 5' 1 3' and translate this mRNA into protein. DNA 3' CGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' MRNA 5' Protein UCAGUCAG UCPG Alanine GU U/c GU A Tyrosine C Stop A G Cysteine Valine G A Stop G Tryptophan Arginine A G AC A C UG ACUGACU C Leucine Serine G C A Lysine Proline Asparagine Glycine alanine Leucine Phenyl- Serine Glutamic acid Aspartic acid Histidine Glutamine Threonine
- The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons b. tRAN anticodons c. amino acidsAnswer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.
- 29. pre-MRNA transcript 5' 3' Open boxes represent introns Filled boxes represent exons A) Draw the MRNA to be translated if the pre-mRNA is constitutively spliced. S B) Draw an mRNA to be translated if the pre-MRNA is alternatively spliced due to exon skipping.3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'