8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the mRNA. Write the corresponding mRNA 5' 3' and translate this mRNA into protein. DNA 3' CCGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' mRNA 5' Protein Arginine Serine Aspartic Karine Lysine C U G Asparagine A Threonine А GU ט כ AC UG NOROUOTOS, Gerine G U Tyrosine Stop Cysteine Stop Tryptophan Leucine Proline

Q: What would be the 5 first nucleotides that form the mRNA?

A: Transcription is an important step in the gene expression in eukaryotes and Prokaryotes. It involves…

Q: The sequence below represents the template strand of DNA of the first two exons (out of 5) of a…

A: DNA is the hereditary material present in most of the eukaryotic organisms.The full form of DNA is…

Q: 16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid…

A: The genetic code is a set of rules used by living cells to translate information encoded in genetic…

Q: 3. Transcribe the following DNA sequences into their corresponding mRNA. (Hint: be sure to pay…

A: Transcription One of the initial steps in gene expression is this procedure. The transport of…

Q: 1. corrected DNA sequences 2.mRNA sequence 3. Amino acid sequence and description 4. Drawing of…

A: The gene is the sequence of DNA which carry information to code for a specific protein or functional…

Q: Examine the following coding strand DNA nucleotide sequence,representing the complete gene sequence…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A…

Q: DNA sense or template DNA sense or template mRNA tRNA protein 5', 3' amino or carboxyl 5' T A U A R…

A: DNA -> Transcription -> mRNA -> Translation -> ProteinTranscription is the synthesis of…

Q: 2. Given a DNA template molecule of 5'- ATGGCTCCTACCTACTAGTTAACATATGG-3', generate the mRNA sequence…

A: We are given a sequence of DNA in 5'-3' direction.  We have to generate the mRNA sequence and then a…

Q: Which process is illustrated in the diagram? Pre-mRNA Exon 1 Lariat Exon 1 BEIN Intron Step 1 Step 2…

A: mRNA splicing is a process by which a newly made precursor messenger (m) RNA transcript is…

Q: 1. For each of the sequences, place an X in the box to indicate the process most immediately…

A: Note: According to the guidelines, we are supposed to answer only one question. Please repost other…

Q: If the template DNA is 3' A GCTAC5' then the mRNA sequence is

A: Ans- As mentioned the DNA template 3’ – A G C T A C – 5’ The mRNA sequence will be – a)          5’…

Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…

A: transcription is the process by which messenger rna is made from dna .

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling…

A: Template Strand:The template strand is indeed the DNA strand that serves as a template during…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: 6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3'-TACT…

A: Wild type sequence:                           3' TACTGACTGACGATC 5' Complementary : 5'…

Q: Which of these is unique to how the MRNA is structured compared to pre-MRNA O MRNA combines with…

A: Note: As Per Bartleby Guidelines For Further Answers Please Repost The Question. Introduction: mRNA…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: If this was an Eukaryote, after this transcript under A (T) (C) C G G DE G g and exits the nucleus…

A: The correct answer is option D. 5; Cap

Q: Provide an mRNA sequence and the protein for the following DNA sequence 5'TCC GGT CAT'3

A: When a cell makes copy of RNA from the piece of  DNA, it is known as transcription. Transcription is…

Q: Identify the parts of a mature mRNA Which of the following is found in the mature mRNA but not in…

A: mRNA It refers to the messenger ribonucleic acid which is single stranded RNA that is read by the…

Q: A. How long will the coding region of the processed mRNA transcript be? (Remember that stop codons…

A: A. In an mRNA exons refer to the coding region while introns refer to the non-coding regions. During…

Q: 63 62 GI GS G4 GGU AUG GCC AUG CUC ACG GAG UAC CGG R (the strane CUC GAG AAG The original template…

A: the process shown in the picture above is is protein translation where protein is translated…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Identify the parts of a matur mich of the following is found in nucleotides 5 can

A: mRNA or messenger RNA are polynucleotide molecules having backbone of ribose sugar and phosphate.…

Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…

A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…

Q: 2ith the diagram provided please write the polypeptide. sequence obtained from the translation of…

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: 1. Create a DNA sequence with eighteen nucleotides. Indicate its 3’ on the left and 5’ on the right…

A: Three parts are solved in case of interlinked question as per our company policy. If you want…

Q: a. What polypeptide is coded for by the mRNA sequence: 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'? N-terminus -…

A: A sequence of three consecutive nucleotides in messenger RNA (mRNA) coding for amino acids is…

Q: 16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid…

A: DNA is a self replicating molecule. The process by which mRNA is produced from DNA is called…

Q: II. Use the eukaryotic gene DNA sequence below to answer the following questions: 1 11 21 31…

A: Codons are sequences of the three nucleotides (adenine, cytosine, guanine, and uracil) which are…

Q: . What is the nucleotide sequence of the complementary strand of the DNA molecule:…

A: DNA or deoxyribose nucleic acid is the genetic material for most organisms. It is a polymer of…