6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for proteinsynthesis which is started by the rest of the base pairs.ACTCCATTGAACCATTTCTATGATCCGCTAACG-...TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-...A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes anidentical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome bindingsequence. What is the sequence of the mRNA that will go to the ribosomes?B. What are the first 6 amino acids of the protein that are coded for by the mRNA?C. What would the amino acid sequence be if...i. a transition mutation occurred on the final G in the mRNA?ii. all of the G & C bases in the protein synthesis portion had transition mutations?iii. a point deletion mutation occurred in the ATA sequence (in the lower strand of DNA which is copiedto mRNA), changing the ATA to AAD. Describe what would happen if a point mutation occurs in (i) the promoter or (ii) ribosome binding segmentsof the gene.

Hi! Thank you for the question. since you have not mentioned which part you are looking for, so we…

Answered: 6. Similar to the class notes (Intro to…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Part II. Transcription as a Process 4. Use the below "transcription bubble model" of a gene during the process of transcription to do following: • Label the 3' and 5' ends of all polynucleotides appropriately • Label the mRNA transcript • Label the template strand HillT لليليلا UFUP 5. What protein is responsible for making the "bubble" in the DNA shown above?
1. Part of a gene is written below, and transcription begins at the boxed T/A base pair and proceeds from left to right. 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGACCTAAGC -3' 56 1 11 + ---+--- ----+-- * a. Draw a green box around the promoter. b. Label the template strand of the DNA on the sequence above. C. Write the sequence of the mRNA. Anticodon sequence: --+--- 3'-GGCTATATTACTCAGCAGCAGACCCGGAAGTACATAAGTACCCTTCTCTGGATTCG ---+-- -5' d. Write the sequence of the peptide that is translated from the mature mRNA and label the directionality of the peptide. e. Give the sequence (and indicate the directionality) of the anti-codon on the tRNA that inserts the 2nd amino acid into the newly made peptide. f. Imagine that, in the process of DNA replication, the 39th base in the gene (with the *) was changed from A/T to C/G. What would be the effect of this mutation on the produced peptide?
24. Why are some eukaryotic proteins not able to be expressed in bacteria? MARK ALL THAT APPLY. Group of answer choices Bacteria are unable to add carbohydrate groups to the surface of proteins Bacteria are too small Bacteria lack the important chaperone proteins required by some eukaryotic proteins to fold properly Protein-encoding genes of eukaryotes are not methylated
1. Using the diagram below: a. Label the process identified by each arrow. b. Label the diagrams below with each of these parts (note the arrow on Gene 2) Is this a prokaryotic or eukaryotic cell? C. Gene 1 ② F Gene 2 start codons transcription terminators stop codons ERRA WORD BANK $7 introns exons promoters
16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid polypeptide: 5'-ATGTGGTCATGA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U A UUU UUC- UUA UUG- CUU CUC CUA CUG- AUU- ACU AUC Ile (1) ACC AUA- ACA AUG Met (M) start ACG GUU GCU GUC GCC GUA GCA GUG- GCG H₂N- U Phe (F) Leu (L) Leu (L) Nonpolar side chains; hydrophobic Val (V) Side chain (R group) H H₂N-C-C-0- HO Glycine (Gly or G) CH₂ H₂N*- CH₂ CH₂ H O Methionine (Met or M) Polar side chains; hydrophilic 0 CH₂ Second base in codon H O Aspartic acid (Asp or D) UCU UCC UCA UCG CCU CCC CCA CCG Alanine (Ala or A) OH CH₂ H₂N-C C 0 H₂N-C C 0 H O Serine (Ser or S) H O Threonine (Thr or T) Electrically charged side chains; hydrophilic OH CH3 CH -0- H₂N+- Acidic (negatively charged) CH₂ H₂N-C-C-O HO C Ser (S) Pro (P) CH₂ CH₂ Thr (T) CH₂ H₂N-C Ala (A)…
10. Why does a cDNA copy of a eukaryotic mRNA gene need to be made in order to determine the expressed protein sequence? Group of answer choices Genomic DNA is methylated and cannot be used as a template Genomic DNA is less stable than cDNA and is therefore harder to work with The genomic DNA sequence in eukaryotes contains introns which need to be removed first Genomic DNA is too long so the shorter mRNA copy is used The 5’ cap gets in the way of protein sequencing
2. For this diagram of transcription and translation in a bacterial cell - help explain the process by.... Identify which part is transcription and which is translation Label the 5' and 3' ends on the mRNA and DNA. Label the arrow with either the N (amino) termini of the protein being made or the C (carboxyl) termini of the protein being made. a. b. C. d. Label the template strand for transcription. e. On the DNA, box the three bases encoding the first amino acid of the protein being made. Box the approximate location on the RNA as well. f. Identify the part of the diagram where tRNAs would bind. in in 5 RNA Polymerase GGGCATGCGCCCTAC mRNA CCCGTACGCGGGATG': ribosome GGCATAAAGCTCCCCAGTTTGCGCGCGCATTGTGATG GIGCCGTATTTCGAGGGGTCAAACGCGCGCGTAACACTAC Promoter
7. The diagram below represents the full mRNA transcribed from the trp operon under conditions of low tryptophan. Grey blocks indicate protein coding sequences. Annotate the diagram by indicating the expected positions of the elements listed below, add more detail to the diagram if required to allow you to accurately annotate it. Use only the letters A - H (e.g. "A" for structural genes). Where a label refers to a region, you must use a bracket to indicate the extent of the region in conjunction with the specific letter. A. Structural genes B. Leader peptide C. Two adjacent trp codons D. 5' UTR and 3' UTR E. Ribosome binding site F. Site of potential transcription termination from attenuation G. Regions with sequence complementarity H. Stretch of Us 5' EDC BA 3'
9. H. State if/how Aureliano's mutation changes the amino acid sequence and describe the effect that change has, if any, on the protein.
6. Use the image to determine what type of mutation is found in each of the DNA strands below and what type of effect that would have on the protein made. OPTIONS: substitution, deletion, translocation, and insertion. DNA: CCC GGG mRNA: CCC Protein: Pro DNA: GAA CTT mRNA: GAA Protein: Glu DNA: TTA AAT mRNA: UUA Protein: Leu CCA GGT CCA Pro GTA CAT GUA Val TAA ATT UAA Stop Type of Mutation Substitution Substitution Substitution What happens when this type of mutation occurs?
3. Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein. Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left. The nucleotides are numbered 1 to 100. NOTE: For this problem, transcription begins with and includes the red and underlined C/G (top strand/bottom strand) base pair and RNA polymerase proceeds from left to right along the DNA. 1 20 40 5'-GTGTCCGTСТААТАТТGTGAGATGTТАТАТСССGCСGTCAАСАССАТСАА-3' +------- +------- ---------+ 3'-САСAGGCAGATTATAACAСТСТАСААТАTAGGGCGGCAGTTCTGGTAGTТ-5' 60 80 100 5'-ACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC-3' ------+ 3'-TGTCCTATTAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG-5' a) Which strand is used as a template for transcription, the top or the bottom? b) Where would the promoter be relative to the start of transcription? c) What are the first 15 nucleotides of the resulting mRNA? Indicate the 5' and 3' ends of the mRNA. d) What…
1. From the given DNA strands:a. Identify the template and non-template strand.b. Give the mRNA product when the DNA is transcribed.c. What is the resulting amino acid sequence which will result from the mRNA?

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS