5. You're working in Marshall Nirenberg's lab, trying to decipher the genetic code. You use several different synthetic repeating MRNAS in translation reactions and analyze the sequences of the polypeptides produced from each reaction. The results are summarized below. MRNA sequence used: ...CACACACACACACAC... Polypeptide produced: ...His-Thr-His-Thr-His-Thr .. MRNA sequence used: ..CCACCACCACCACCA... Polypeptide produced: ...Thr-Thr-Thr... and .Pro-Pro-Pro... and.His-His-His... MRNA sequence used: ...ACAACAACAACAACA... Polypeptide produced: .Thr-Thr-Thr... and .Asn-Asn-Asn... and .Gln-Gln-Gln.. Based on these results, write what amino acid each codon below corresponds to. If there is not enough information to narrow down to one amino acid, write all the possibilities. Do not make any assumptions and deduce the answers with only the information provided: САC: АС: АСА: САА: ССА: ААC:

Q: put in correct order the steps for initiating translation. 1. Binding of initiator tRNA to mRNA 2.…

A: The translation is the process by which cells make proteins. Here, the mRNA formed by transcription…

Q: The genetic code was deciphered by experiments in which synthetic polyribonucleotides of known…

A: Hi dear, here's your answer.please like it .

Q: What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: 2. Complete the leading strand and the complementary strand with the 5'and 3' ends and identify the…

A: DNA acts as the genetic material in most of the organisms present on earth. DNA is first transcribed…

Q: How would you choose where to begin your reading of a sequence in mRNA?  Which rule governing the…

A: The translation is the process by which polypeptide chain (protein) is produced from the mRNA…

Q: Based on your know | (hir sequence.

A: In many eukaryotic (and other prokaryotic) genes, the original RNA extracted from a genetic DNA…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Choose the answer that has these events of the elongation phase of translation in the proper…

A: Translation refers to the production of proteins using mRNA and ribosomal machinery. The ribosome…

Q: Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the…

A: Protein consists of amino acids.

Q: Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What…

A: Gene expression is the process by which the instructions in our DNA are converted into a functional…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: What is the consensus sequence of the following six DNA…

A: DNA or the Deoxyribonucleic acid present in both eukaryotes and prokaryotes are made up of millions…

Q: . The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…

A: Arginine is coded by six mRNA codons.

Q: You have isolated a new organism from a sulfur hot springs in Yellowstone and are investigating its…

A: Option b

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: DNA from a eukaryotic gene was isolated, denatured, and hybridized to the mRNA transcribed from the…

A: The observed diagram is the digramatic representation of the ongoing splicing process. Splicing is a…

Q: I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: After translation a protein needs to be folded correctly in order to function properly: C) What…

A: Proteins are long chains of amino acids. There are 4 types of proteins based on their structure:…

Q: The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that…

A: The genetic framework is a collection of instructions used by living cells to decipher data encoded…

Q: Where and for what reason (s) are you likely to observe the letter "N" in your Sanger sequence…

A: Sanger sequencing, also known as chain-termination sequencing, is a method for determining the…

Q: Below is a polinucleotide sequence of the non-template strand of a coding DNA sequence. Use the info…

A: Central dogma of molecular biology:   It states that the DNA which contains the genes are…

Q: Using the following coding DNA sequence:TAC GCA CCT TTA GAT CAT AAC TTT GGA ACT1. Write the…

A: Deoxyribose nucleic acid (DNA) is the genetic material composed of four nucleotide bases, namely…

Q: You have an mRNA transcript that is 201 nucleotides long, including the Start and Stop codons.  How…

A: In most living organisms, DNA is the genetic material. DNA contains all the genetic instructions…

Q: Consider the following DNA sequence, which codes for a short polypeptide:…

A: A codon is a sequence of three nucleotides (in DNA or mRNA) that specifies a particular amino acid…

Q: The following DNA sequence corresponds to the two extreme ends of a gene's coding region: 5'…

A: Introduction = The genetic code consists of tripletsThe group of three nucleotides that together…

Q: What are the specific steps of eukaryotic translation? Be sure in your discussion that you include…

A: In transcription, a cell “copies” DNA sequence to a complementary RNA molecule. Then, in…

Q: Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as…

A: Let's rearrange the mRNA in the codes of three.  ACG UCC AAU GGC AGU GAU UUG AAU CCA ACG codes for…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: 2a) In prokaryotes, a small ribosomal subunit can potentially get on an mRNA anywhere it can find…

A: The translation is the process of polymerization of amino acids to form polypeptides or protein. It…

Q: Your labmate gives you a gene with the following sequence of the coding strand for the first 5 amino…

A: given DNA strand first form the complimentary starnd by changing A - T and G-C for the strand 3' to…

Q: You’re working in Marshall Nirenberg’s lab, trying to decipher the genetic code. You use several…

A: Marshall Nirenberg studied the genetic codes for protein synthesis in his biochemical research. He…

Q: You are studying a eukaryotic gene in which translation normally begins at the second AUG in the…

A: Self-explanatoryPlease give me a helpful rating if you are satisfied with my answer

Q: . Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the…

A: “Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts…

Q: What mRNA base sequences are complementary to the following DNA template sequences? Be sure to label…

A: The process by which the mRNA is transcribed from the parental DNA is known as the process of…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: How can you identify the start codon in the mRNA sequence ?

A: mRNA sequence During the process of translation, mRNA is read on the basis of genetic code that…

Cancer Therapy