1.) Define transcription and translation. How does transcription and translation differ in prokaryotes vs. eukaryotes (i.e. What is present in one but not the other)? 2.) What it means when we say that genetic code is redundant? 3.) Describe the stages of transcription (in detail for each step) - what components are required? 4.) Describe the stages of translation in eukaryotes (initiation, elongation, termination)

Q: 69. Which of the following statements about RNA splicing is false? A) Introns are not found in…

A: RNA splicing permits numerous functional mRNAs to be produced from a single transcript that codes…

Q: 5. Consider eukaryotic transcription: a) Draw a eukaryotic gene and label key sequences. (5 points)

A: A eukaryotic gene, consists of a set of sequences that appear in mature mRNA interrupted by introns.…

Q: put in correct order the steps for initiating translation. 1. Binding of initiator tRNA to mRNA 2.…

A: The translation is the process by which cells make proteins. Here, the mRNA formed by transcription…

Q: What are the differences between translation and transcription in bacteria and eukaryotes? Give a…

A: Differences:                                     Bacteria…

Q: Which of the following types of enzymes is primarily responsible for setting up the genetic code?…

A: Enzymes are the biocatalyst ,which increases the rate of chemical reactions in the body.Most of the…

Q: DNA sequence

A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…

Q: The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the…

A: Introduction  Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: How does the process of transcription differ between prokaryotes and eukaryotes?

A: Transcription is the process by which DNA is copied into RNA. While the overall process of…

Q: 1) RNA polymerase 2) sigma (o) subunit of RNA polymerase 3) rho (p) factor 4) transcription factors…

A: RNA polymerase  extend or polymerise RNA.   Sigma subunit of RNA polymerase binds to promoter…

Q: The central dogma occurs in both prokaryotes and eukaryotes. Transcription and translation occurs in…

A: Central dogma is a process by which instructions present in DNA are converted into the useful…

Q: Transcription is the first step in gene expression. It involves copying a gene's DNA sequence to…

A: Rho factor works by binding to the transcript and halts transcription by actually breaking hydrogen…

Q: 2. Complete the leading strand and the complementary strand with the 5'and 3' ends and identify the…

A: DNA acts as the genetic material in most of the organisms present on earth. DNA is first transcribed…

Q: Which of the following parts of translation is significantly different in eukaryotes and…

A: mRNA or messenger RNA carries genetic information as nucleotide sequence copied from template DNA…

Q: What is an Okazaki fragment, and how are they later “glued” together?

A: In the semi discontinuous mode of replication when DNA unwinds , one strand is synthesized…

Q: 1)post translational  processing of polypeptide chains including…

A: Protein synthesis or translation is the process by which mRNA is translated into protein using tRNA…

Q: Based on your know | (hir sequence.

A: In many eukaryotic (and other prokaryotic) genes, the original RNA extracted from a genetic DNA…

Q: Choose the answer that has these events of the elongation phase of translation in the proper…

A: Translation refers to the production of proteins using mRNA and ribosomal machinery. The ribosome…

Q: Match the function in translation to each type of RNA (one RNA has two listed functions). 1) Carry…

A: The process where RNA transformed into protein called translation. There are all three types of…

Q: the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the…

A: The process of formation of messenger RNA with the help of template strand of DNA is called…

Q: A) Describe each step of the DNA REPLICATION in EUKARYOTIC organisms B) Describe each step of the…

A: Transcription = Re-writing DNA into RNADNA is "transcribed" or re-written into RNA in a very…

Q: What is the difference between transcription and translation during the central dogma of molecular…

A: The gene expression is divided by mainly two steps that are transcription and translation. Together…

Q: For a transmembrane protein in the plasma membrane, where in the cell is its translation initiated?…

A: Introduction Plasma Membrane is the outer membrane of animal cell. It is a semi permeable membrane.…

Q: 9. In eukaryotic gene expression, non-coding RNAS such as miRNA (microRNA important role in gene…

A: Ribonucleic acid is a nucleic acid found in all living organisms. The term "RNA interference" refers…

Q: 1. If the gene above is transcribed into a functional mRNA,  a.) how many codons will be carried by…

A: a) 64 codons will be carried by the functional mRNA, 61 represent amino acids, and the remaining…

Q: Chloramphenicol blocks the peptidyl transferase reaction on ribosomes. The specific effect of this…

A: Transcription:  It is the process of formation of RNA transcript from DNA template by the enzyme DNA…

Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…

A: Transcription is the process of the formation of RNA from DNA. Through transcription, the…

Q: transcription and translation. What

A: Transcription is the process of copying a gene's DNA sequence to make an RNA molecule and…

Q: Below is a template strand of DNA. Assume the transcription start site is outside of this sequence…

A: Transcription is the initial phase in gene expression, where data from a gene is utilized to develop…

Q: Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene:…

A: The double-stranded DNA molecule is made up of two DNA strands known as the template strand and the…

Q: Select the following descriptions of gene transcription regulation in eukaryotes that are…

A: * Post translational modification are covalent and enzymatic modifications of proteins that follows…

Q: After translation a protein needs to be folded correctly in order to function properly: C) What…

A: Proteins are long chains of amino acids. There are 4 types of proteins based on their structure:…

Q: (A) Prokaryotic gene expression is a complex process that is controlled at many levels…

A: Since you have posted multiple questions, we will provide the solution only to the first question as…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Which of the following is a possible consequence of a mutation that introduces a premature stop…

A: The stop codons are the specific genetic codon that do not codes any amino acids during the…

Q: 14) Why are telomeres so important in eukaryotic organisms: A) Without telomeres, important DNA…

A: Telomeres are the section of a chromosome that is found at the end and does not contain any genetic…

Q: During translation elongation, in which site do new tRNAs enter?   a) D site b) E site c) A site…

A: DNA => Transcription => mRNA => Translation => Protein. Protein synthesis ( ribosome…

Q: translation in prokaryotes

A: Translation is the mechanism to synthesis of peptide chain from mRNA sequence. The initiation of…

Q: Give 7 examples where a specific nucleotide sequences/elements are recognized by protein or…

A: Replication is the process by which new strands of DNA are synthesized from pre-existing DNA.…

Q: 70

A: The conversion of information saved in the DNA to proteins is required. The central dogma describes…

Q: The following DNA sequence is found on a chromosome in rice plants:               5’…

A: Given DNA sequence:  5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ Since, this is the…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.