Transcription and translation are separate processes in gene expression; however, they have similarities. The following terms all relate to translation. Which of these has a role that is most similar to that of the transcription start site during transcription? A)Start codon B)Stop codon C)tRNA D)Amino acid

Q: Which of the following is NOT true regarding the genetic code and translation? a) An mRNA is…

A: Deoxyribonucleic acid or DNA is a type of nucleic acid that is present in the nucleus of the cell.…

Q: The -35 and-10 consensus sequences upstream from the transcription start site are A) O located in…

A: Transcription is the process of formation of mRNA (messenger ribonucleic acid) from the DNA…

Q: In a eukaryotic cell, four general types of RNA molecules are involved in gene expression.  a) What…

A: The gene expression is the production of protein from the a gene. That means it involves…

Q: The piece of RNA below includes the region that codes for the binding site for the initiator tRNA…

A: Translation is a fundamental process in molecular biology that converts the genetic information…

Q: The process of translation involves three distinct phases: initiation, elongation, and termination.…

A: Translation is the process by which a protein is synthesized from the information contained in a…

Q: The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome:…

A:

Q: During translation elongation, in which site do new tRNAs enter?   a) D site b) E site c) A site…

A: DNA => Transcription => mRNA => Translation => Protein. Protein synthesis ( ribosome…

Q: Explain briefly how translation is initiated from a) prokaryotic mRNA and b) eukaryotic mRNA.…

A: The translation is the process of using the genetic information in mRNA to create a protein. In the…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: Transcription is the process in which RNA is synthesized from DNA.

Q: Most amino acids are coded for, by more than one codon. Consequently the genetic code is…

A: Introduction: The genetic code is a set of laws that define how DNA's four-letter code is translated…

Q: Which of the following recognizes the mRNA codon 5' - U A A - 3'?

A: Firstly, information is transferred from the DNA to mRNA by the process known as transcription. Then…

Q: The characteristic way in which the DNA molecule is copied to form mRNA is most related to: a) the…

A: Introduction Transcription takes place in the nucleus, During transcription, It uses DNA as a…

Q: re-mRNA must undergo which of the following modifications before leaving the ucleus? a) introns…

A: Gene expression begins with the transcription of DNA into messenger RNA (mRNA), which is then…

Q: introns: A)are parts of the new strand replaced with DNA nucleotides during replication B)Are joined…

A: Genes coding for proteins are present in cellular DNA. Gene expression for synthesis of proteins…

Q: All of these materials are needed for translation EXCEPT: a) amino acids b) mRNA c) tRNA d) RNA…

A: Translation occurs in four phases: activation (prepare), initiation (start), elongation (make…

Q: A given coding strand sequence in a Eukaryote is as follows 5'GGGAATATAA GACCGATGGA GGGTACAG…

A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…

Q: Which of the following statements about gene expression is false?a) More than one RNA polymerase can…

A: DNA is a polynucleotide molecule, is a genetic material for most of the species on earth. The DNA…

Q: Eukaryotic mRNA is modified by: A) Addition of a 5'-cap B) Addition of a poly-A tail C) Removal of…

A: Introduction  A ribosome reads messenger ribonucleic acid, a single-stranded RNA molecule that…

Q: Define both transcription and translation. In addition, describe the role(s) of each of the…

A: The two main steps involved in protein synthesis are transcription and translation. These two…

Q: There may be more than one answer for each  Expression of mRNA can be regulated by which of the…

A: There are a few important points : RNA polymerase is responsible for the transcription of all…

Q: triplet of bases on an mRNA molecule is known as a(n)

A: A triplet of bases on an mRNA molecule is known as a(n) Answer: c)  codon.