Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 9QP
What are the three modifications made to pre-mRNA molecules before they become mature mRNAs, are transported from the nucleus to the cytoplasm, and become ready to be used in protein synthesis? What is the function of each modification?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What are the three modifications made to pre-mRNA molecules before they become mature mRNAs that are ready to be used in protein synthesis? What is the function of each modification?
How is the mRNA strand altered during mRNA processing (the intermediate step between transcription and translation)? How are these modifications helpful?
After the intron (which is in a lariat configuration) is released during pre-mRNA splicing, a brief moment occurs before the two exons are connected to each other. Which snRNP(s) hold(s) the exons in place so they can be covalently connected to each other?
Chapter 9 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
Ch. 9.6 - Antibiotics and Protein Synthesis Antibiotics are...Ch. 9.6 - Antibiotics and Protein Synthesis Antibiotics are...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - The Link Between Genes and proteins The genetic...Ch. 9 - Define replication, transcription, and...Ch. 9 - If the genetic code used 4 bases at a time, how...Ch. 9 - If the genetic code uses triplets, how many...Ch. 9 - What is the start codon? What are the stop codons?...
Ch. 9 - Is an entire chromosome made into an mRNA during...Ch. 9 - The promoter and terminator regions of genes are...Ch. 9 - The following segment of DNA codes for a protein....Ch. 9 - What are the three modifications made to pre-mRNA...Ch. 9 - The pre-mRNA transcript and protein made by...Ch. 9 - Briefly describe the function of the following in...Ch. 9 - Prob. 12QPCh. 9 - Determine the percent of the following gene that...Ch. 9 - How many kilobases of the DNA strand below will...Ch. 9 - Prob. 15QPCh. 9 - Given the following tRNA anticodon sequence,...Ch. 9 - Given the following mRNA, write the...Ch. 9 - The following is a portion of a protein:...Ch. 9 - Below is the structure of glycine. Draw a...Ch. 9 - Indicate in which category, transcription or...Ch. 9 - Prob. 21QPCh. 9 - Polypeptide folding is often mediated by other...Ch. 9 - Do mutations in DNA alter proteins all the time?Ch. 9 - a. Can a mutation change a proteins tertiary...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What is the "genetic code" and what aspect of post translational modification virtually mandates that "genetic code" applies to mRNA rather than DNA?arrow_forwardThe asterisk (*) in the diagram below indicates a single base mutation in the 5' splice site of the second intron of a eukaryotic gene. Due to this mutation, the second intron is now not ‘spliced out’ during the splicing process. What are the most likely consequences of this mutation with respect to the size of the pre-mRNA and the size of the mature mRNA? a. The pre-mRNA will be longer and the mature mRNA will be longer. b. The pre-mRNA will be longer and the size of the mature mRNA will not be affected c. The size of the pre-mRNA will not be affected and the mature mRNA will be longer d. The size of the pre-mRNA will not be affected and the size of the mature mRNA will not be affectedarrow_forwardwhat is it called when an mRNA is edited and where does it happen?arrow_forward
- Is there any complementarity between DNA and a transcribed mRNA? In which direction is the mRNA synthesized?arrow_forwardWhat Determine the amount of mRNA that is available for translation ?arrow_forwardA single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using the same strand above as a template, write the pre-mRNA transcript. b) List the molecules that must be present for DNA to be transcribed. Briefly describe their function. c) What are three modifications that happen to pre-mRNA before it becomes mature mRNAarrow_forward
- In addition to splicing, additional modifications at the ends are required to generate a mature MRNA. What are these modifications and what are their significance? Use the following terms to fill in the blanks: MRNA cap poly(A) tail nucleus cytoplasm ribosome transcription complex synthesis degradation modifications The 5' end receives a while the 3' end gets a These modifications allow the MRNA to be exported to the A · protect it from and helps the MRNA to be recognized by thearrow_forwardWhich of the followings indicate the order of procaryotic mRNA degreadation? cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestion- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme cleavage of the triphosphate 5′ terminus to yield a monophosphate- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- 3′ to 5′exonuclease digestion The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestionarrow_forwardEukaryotic mRNA has a significantly longer half life than its prokaryotic counterpart. How is this accomplished in eukaryotes? What processes tend to degrade mRNA molecules in both eukaryotes and prokaryotes, and why are these processes needed?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY