Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 9QP
What are the three modifications made to pre-mRNA molecules before they become mature mRNAs, are transported from the nucleus to the cytoplasm, and become ready to be used in protein synthesis? What is the function of each modification?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What are the three modifications made to pre-mRNA molecules before they become mature mRNAs that are ready to be used in protein synthesis? What is the function of each modification?
After the intron (which is in a lariat configuration) is released during pre-mRNA splicing, a brief moment occurs before the two exons are connected to each other. Which snRNP(s) hold(s) the exons in place so they can be covalently connected to each other?
What is the "genetic code" and what aspect of post translational modification virtually mandates that "genetic code" applies to mRNA rather than DNA?
Chapter 9 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
Ch. 9.6 - Antibiotics and Protein Synthesis Antibiotics are...Ch. 9.6 - Antibiotics and Protein Synthesis Antibiotics are...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - The Link Between Genes and proteins The genetic...Ch. 9 - Define replication, transcription, and...Ch. 9 - If the genetic code used 4 bases at a time, how...Ch. 9 - If the genetic code uses triplets, how many...Ch. 9 - What is the start codon? What are the stop codons?...
Ch. 9 - Is an entire chromosome made into an mRNA during...Ch. 9 - The promoter and terminator regions of genes are...Ch. 9 - The following segment of DNA codes for a protein....Ch. 9 - What are the three modifications made to pre-mRNA...Ch. 9 - The pre-mRNA transcript and protein made by...Ch. 9 - Briefly describe the function of the following in...Ch. 9 - Prob. 12QPCh. 9 - Determine the percent of the following gene that...Ch. 9 - How many kilobases of the DNA strand below will...Ch. 9 - Prob. 15QPCh. 9 - Given the following tRNA anticodon sequence,...Ch. 9 - Given the following mRNA, write the...Ch. 9 - The following is a portion of a protein:...Ch. 9 - Below is the structure of glycine. Draw a...Ch. 9 - Indicate in which category, transcription or...Ch. 9 - Prob. 21QPCh. 9 - Polypeptide folding is often mediated by other...Ch. 9 - Do mutations in DNA alter proteins all the time?Ch. 9 - a. Can a mutation change a proteins tertiary...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The asterisk (*) in the diagram below indicates a single base mutation in the 5' splice site of the second intron of a eukaryotic gene. Due to this mutation, the second intron is now not ‘spliced out’ during the splicing process. What are the most likely consequences of this mutation with respect to the size of the pre-mRNA and the size of the mature mRNA? a. The pre-mRNA will be longer and the mature mRNA will be longer. b. The pre-mRNA will be longer and the size of the mature mRNA will not be affected c. The size of the pre-mRNA will not be affected and the mature mRNA will be longer d. The size of the pre-mRNA will not be affected and the size of the mature mRNA will not be affectedarrow_forwardA single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using the same strand above as a template, write the pre-mRNA transcript. b) List the molecules that must be present for DNA to be transcribed. Briefly describe their function. c) What are three modifications that happen to pre-mRNA before it becomes mature mRNAarrow_forwardHow do we know that mRNA exists and serves as an intermediate between information encoded in DNA and its concomitant gene product?arrow_forward
- Where in eukaryotic cells does mRNA synthesis occur? To where do these molecules migrate?arrow_forwardIn addition to splicing, additional modifications at the ends are required to generate a mature MRNA. What are these modifications and what are their significance? Use the following terms to fill in the blanks: MRNA cap poly(A) tail nucleus cytoplasm ribosome transcription complex synthesis degradation modifications The 5' end receives a while the 3' end gets a These modifications allow the MRNA to be exported to the A · protect it from and helps the MRNA to be recognized by thearrow_forwardEukaryotic mRNA has a significantly longer half life than its prokaryotic counterpart. How is this accomplished in eukaryotes? What processes tend to degrade mRNA molecules in both eukaryotes and prokaryotes, and why are these processes needed?arrow_forward
- Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protienarrow_forwardWhat are the “protein synthesis factories?” Give an overview of the relationship between these “factories” and mRNA to explain why they are called the “protein synthesis factories.arrow_forwardMRNAs and eukaryotic cells receive different modifications than those in prokaryotic cells, because eukaryotic mRNAs must be able to accomplish different things. Which of the following describes events that are necessary for an mRNA to be expressed in a eukaryotic cell, but are not necessary for mRNAs in a prokaryotic cell? select all that apply A) introns must be removed from the eukaryotic mRNA B) The mRNA must leave from the nucleus C) transcription factors must bind to the mRNA in a eukaryotic cell after it is transcribed D) A ribsome must bind to the mRNA .arrow_forward
- a) The deacetylation of histones generally causes gene inactivation. True or false? b)During eukaryotic translation, the first contact between the ribosome and the mRNA is usually made when the small ribosomal subunit directly binds to the translational start site (Kozak sequence) on the mRNA. True or false? c)The termination of translation is carried out by a single tRNA molecule that recognizes all three stop codons. True or false? d) The deamination of cytosine, which produces uracil, is less likely to be repaired, compared to the deamination of 5-methylcytosine, which produces thymine.True or false? e)An HLH-bHLH heterodimer can bind DNA. True or false? F)Chromatin remodeling complexes posseses ATPase activity. True or false? g)Histone methylation generally causes gene inactivation. True or false? h) A pre-mRNA is cleaved downstream of its polyA signal before the transcription terminates. True or false? i) During X chromosome inactivation in female mammals, most genes are repressed…arrow_forwardUsing what is known about the location of introns, a methylguanosine cap, and a poly-A tail, the direction of mRNA synthesis, and the cotranscriptional mechanism of RNA processing, propose the chronological order in which each of these modifications occurs to an mRNA: Splicing, Capping, Polyadenylationarrow_forwardIn eukaryotes, what types of modifications occur to pre-mRNAs?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY