Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 8QP
The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Here is part of a gene:
GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC
If the bottom strand of the DNA carries the gene, write the mRNA that would be transcribed from the bottom strand of the DNA:
The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that we used last week. The mutations can be seen underlined in purple (You can use your mature RNA to skip some steps, just make sure to change the nucleotides that are marked below.
With this information please answer the questions below.
What is the sequence of the polypeptide that will be generated from the mature mRNA?
write a
"-" between each amino acid. All in caps.
Write STOP for the stop codon.
Example
ALA-LEU-MET-ILE...
In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then, for each set of three DNA and complementary mRNA nucleotides, use the amino acid chart to translate the nucleotides into amino acids, and type them below.
DNA
T-A-C
A-A-G
A-T-G
G-G-G
A-T-T
mRNA
Enter Text
—
Enter Text
—
Enter Text
Enter Text
—
Enter Text
—
Enter Text
Enter Text
—
Enter Text
—
Enter Text
Enter Text
—
Enter Text
—
Enter Text
Enter Text
—
Enter Text
—
Enter Text
Amino acid
Enter Text
Enter Text
Enter Text
Enter Text
Enter Text
Chapter 9 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
Ch. 9.6 - Antibiotics and Protein Synthesis Antibiotics are...Ch. 9.6 - Antibiotics and Protein Synthesis Antibiotics are...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - The Link Between Genes and proteins The genetic...Ch. 9 - Define replication, transcription, and...Ch. 9 - If the genetic code used 4 bases at a time, how...Ch. 9 - If the genetic code uses triplets, how many...Ch. 9 - What is the start codon? What are the stop codons?...
Ch. 9 - Is an entire chromosome made into an mRNA during...Ch. 9 - The promoter and terminator regions of genes are...Ch. 9 - The following segment of DNA codes for a protein....Ch. 9 - What are the three modifications made to pre-mRNA...Ch. 9 - The pre-mRNA transcript and protein made by...Ch. 9 - Briefly describe the function of the following in...Ch. 9 - Prob. 12QPCh. 9 - Determine the percent of the following gene that...Ch. 9 - How many kilobases of the DNA strand below will...Ch. 9 - Prob. 15QPCh. 9 - Given the following tRNA anticodon sequence,...Ch. 9 - Given the following mRNA, write the...Ch. 9 - The following is a portion of a protein:...Ch. 9 - Below is the structure of glycine. Draw a...Ch. 9 - Indicate in which category, transcription or...Ch. 9 - Prob. 21QPCh. 9 - Polypeptide folding is often mediated by other...Ch. 9 - Do mutations in DNA alter proteins all the time?Ch. 9 - a. Can a mutation change a proteins tertiary...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).arrow_forwardThe following is a prokaryotic DNA sequence. Fill in the other strand of DNA. Be sure to label the ends appropriately (5’ and 3’). Transcription goes from left to right and stops after the right most base pair. On your DNA, indicate which is the coding/partner and which one is the template. Write out the pre-mRNA transcript. Be sure to label the ends appropriately (5’ and 3’). DNA 5’ – T G G G G G A T A C C G C A T G C A G G T A G T C T A A G C G A G T G A C – 3’ DNA mRNAarrow_forwardTranslate this nucleotide sequence into an amino acid sequence. Gene Sequence (5'-to-3'):…arrow_forward
- Using the genetic code, translate your mRNA sequence of 60 nucleotides into a polypeptide. Use one-letter abbreviations for the amino acids. Enter one-letter abbreviations corresponding to the amino acids.arrow_forwardThe following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. Draw or write-out a) the sequence of the primary transcript and b) the mature mRNA resulting from this stretch of DNA.arrow_forwardMessenger RNA is single-stranded molecule while TRNA and rRNA molecules are double-stranded molecules to be able to help in the process of translation at the ribosome. Select one: True Falsearrow_forward
- Identify the middle, end and beginning sequence. Use your knowledge of start and stop codons to figure it out. Remove codons 24 to 66, including codon 66.arrow_forwardThe code for a fully functional protein is actually coming from an mRNA transcript that has undergone post-transcriptional processing which is essentially way too different from the original code in the DNA template. Given: GUC-CAC-UUA-ACC-CCU-GAG-GAG-AAA-UCG-GCC (Protein with known amino acid sequence) Requirement: Original DNA code. Itemize the steps you would take to get to know the original DNA code of the protein in focus.arrow_forwardThe code for a fully functional protein is actually coming from an mRNA transcript that has undergone post transcriptional processing which is essentially way too different from the original code in the DNA template. Given: Protein with known amino acid sequence Requirement: Original DNA code (itemize the steps you would take to get to know the original DNA code of the protein in focus)arrow_forward
- The code for a fully functional protein is actually coming from an mRNA transcript that has undergone post-transcriptional processing which is essentially way too different from the original code in the DNA template. Given: Val-His-Leu-Thr-Pro-Glu-Glu (Protein with known amino acid sequence) Requirement: Original DNA code. Itemize the steps you would take to get to know the original DNA code of the protein in focus.arrow_forwardAKS 5c1: The model below represents the process of protein synthesis. What is the best description for what occurs during process A and process B in the model? * AA A GA TIT TT G CITG GCITAG |A AMGAA MAQ IB phenyl- alanine leucine alanine glycine methionineH iysine Process A is showing transcription, which uses a DNA template to create an mRNA copy of the genetic code. Process B is showing translation, which uses the MRNA to create a polypeptide chain. Process A is showing translation, which uses a DNA template to create an MRNA copy of the genetic code. Process B is showing transcription, which uses the MRNA to create a nolynentide chain ATarrow_forwardComplete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acidarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY