Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 10QP
The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site.
- a. normal-length transcript, normal-length nonfunctional protein
- b. normal-length transcript, no protein made
- c. normal-length transcript, normal-length mRNA, short nonfunctional protein
- d. normal-length transcript, longer mRNA, shorter nonfunctional protein
- e. transcript never made
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Below is a graphical representation of eukaryotic precursor mRNA. A. Outline each modification that must happen to get a mature m-RNA. B. How does the absence of introns in prokaryotic genes affect prokaryotic gene expression?
C. How will gene expression be affected if all of the spliceosomes are removed from the bacteria sample? Explain.
Arrange the statements in their proper order by writing the corresponding letter
(e.g. A) for each statement in the space provided below.
A. The single-stranded RNA would complement the target RNA.
B. Gene expression is inactivated once the mRNA is no longer accessible for
translation.
C. The risk-induced silencing complex which is composed of RNA and protein
subunits is formed.
D. Double-stranded, non-coding RNA is cleaved by Dicer.
E. The mRNA can be cleaved or remain bound by the RISC.
1.
2.
3.
4.
5.
The following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene Z and the underlined and italicized sequence encodes the gene Z ribosome binding (RBS) site. Transcription begins at and includes the T/A base pair at position 60 (bold).
a. What are the nucleotides of the mRNA from gene Z?b. What are the amino acids encoded by gene Z? (A codon chart is found on the final page)
Chapter 9 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
Ch. 9.6 - Antibiotics and Protein Synthesis Antibiotics are...Ch. 9.6 - Antibiotics and Protein Synthesis Antibiotics are...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - The Link Between Genes and proteins The genetic...Ch. 9 - Define replication, transcription, and...Ch. 9 - If the genetic code used 4 bases at a time, how...Ch. 9 - If the genetic code uses triplets, how many...Ch. 9 - What is the start codon? What are the stop codons?...
Ch. 9 - Is an entire chromosome made into an mRNA during...Ch. 9 - The promoter and terminator regions of genes are...Ch. 9 - The following segment of DNA codes for a protein....Ch. 9 - What are the three modifications made to pre-mRNA...Ch. 9 - The pre-mRNA transcript and protein made by...Ch. 9 - Briefly describe the function of the following in...Ch. 9 - Prob. 12QPCh. 9 - Determine the percent of the following gene that...Ch. 9 - How many kilobases of the DNA strand below will...Ch. 9 - Prob. 15QPCh. 9 - Given the following tRNA anticodon sequence,...Ch. 9 - Given the following mRNA, write the...Ch. 9 - The following is a portion of a protein:...Ch. 9 - Below is the structure of glycine. Draw a...Ch. 9 - Indicate in which category, transcription or...Ch. 9 - Prob. 21QPCh. 9 - Polypeptide folding is often mediated by other...Ch. 9 - Do mutations in DNA alter proteins all the time?Ch. 9 - a. Can a mutation change a proteins tertiary...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forwardIdentify the best match between the mutation description and term. a. Transversion: results in a change in single nucleotide from a purine to another purine or a pyrimidine to another pyrimidine b. Nonsense mutation: a change in the DNA that changes the codon code from one amino acid to another amino acid c. Missense mutation: causes a drastic change in phenotype because the change causes a premature stop in the amino acid sequence d. Indel: has the potential to cause large changes in transcription and subsequence amino acid sequence due to reading frameshiftsarrow_forwardThe coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.arrow_forward
- Nuclear (N) and cytoplasmic (C) mRNA samples of a gene with 2 exons and one intron run on an agarose gel along with a size marker, are shown in the gel figure below. Ntds = nucleotides 3. What is the length of the primary mRNA? HINT: Check question 3c RNA sample: N a. C ntds 1900- b. What is the length of the processed MRNA? 1250 1000 800- 650 с. If the 1250 nucleotide and 650 nucleotide fragments are spliced mRNA intermediates as indicated in the splicing diagram below, what is the size in nucleotides of Exon 1 & Exon 2. Size 1 Markers Exon Intran Exon pre-MRNA AG GU (1) (2) I spliced MRNA 2.arrow_forwarda. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and 3' ends. b. translate this RNA sequence in 1a into a protein sequence c. Give the sequence of mRNA that would be transcribed off of the top strand and label its 5' and 3' ends. d. Translate this RNA sequence in 1c into a protein sequencearrow_forwardGive typing answer with explanation and conclusion Which description applies to alternative mRNA splicing? 1. heritable changes in gene expression that occur without altering the DNA sequence 2. processing of exons in mRNA that results in a single gene coding for multiple proteins 3. mRNA modifications such as additions of a 5′‑cap and 3′ poly‑A tail and removal of introns 4. a gene cluster controlled by a single promoter that transcribes to a single mRNA strand 5. protein modifications such as addition of a functional group or structural changes such as folding Answer 2 is correct.arrow_forward
- For a specific type of mutation at a given location in a particular gene, identify whether it will affect the size of the mRNA, the protein, or both. How would the mutant appear on a gel in comparison to the originalarrow_forwardDefine the following terms: a. Okazaki fragment b. ter region c. tus protein d. transcription preinitiation complex e. ORCarrow_forwardA peptide is produced in two different cells. The primary structure is the same in both cells, but the amount of peptide is increased in one cell. What could be happening to the pre-mRNA or mRNA transcript within the cell that has the higher amount of this peptide? A. It has a shorter Poly-A tail B. An alternative polyadenylation (Poly-A) site is being selected C. Leaky scanning occurred D. B and C are both correct OE. None of the abovearrow_forward
- a) Complete the table below. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. Label the 5’ and 3’ ends of DNA and RNA and carboxy and amino acid ends of protein. (You may fill in this chart by hand writing- no typing necessary here.) 2. b) Is the top or bottom DNA strand the template strand?arrow_forwarda. What is grey donut shaped object supposed to represent? b. Label with the word "promoter" where one might find the promoter region in this image. c. In the magnified insert, label the template strand that is being transcribed with the word "template". d. In the magnified insert label the 5' and 3' ends of the transcript. e. What entity functions to break the complementary base pairing of a gene at its transcription start site? CS Scanned with CamScannerarrow_forwardDifferential RNA splicing may result in: a. A shift in the ratio of mRNA produced from two neighboring genes b. Inversion of exons in the mature mRNA c. Production of the same protein from two different genes d. Production of two different proteins with different properties from a single genearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY