Describe translation in eukaryotes by answering each part below:  - What are the players (the most important enzymes, proteins, or components)? And what does each do (specifically)?  - Describe each of the three stages of translation in your own words. Be sure to include the key players in your description. - Provide one similarity between prokaryote and eukaryotic translation and two differences.

Q: Transcription is the first step in gene expression. It involves copying a gene's DNA sequence to…

A: Rho factor works by binding to the transcript and halts transcription by actually breaking hydrogen…

Q: When summarizing the process of transcription in a cell as a gene is used to build a polypeptide,…

A: Introduction  A DNA fragment is copied into RNA during transcription. Messenger RNA is the term for…

Q: In eukaryotic cells, secreted proteins are initially directed to the endoplasmic reticulum and then…

A: Introduction The secretory pathway refers to the endoplasmic reticulum, Golgi apparatus and the…

Q: How does initiation of translation occur in prokaryotes? Include a discussion of the ribosomal…

A: Like transcription, the process of translation also involves three successive stages- initiation,…

Q: 2.5 Which of the following is true about translation? A) The anticodon in the transfer RNA is…

A: t- RNA is called transfer RNA which changes to amino acyl RNA with help of the aminoacyl t-RNA…

Q: Consider this list (below) of steps involved in translation. These steps are out of order.…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum generate…

Q: what percentage of the total amino acids in the protein would be made up of proline (Pro)?

A: Proline is an amino acid codded by the codons CCG, CCC, CCU, and CCA. Any one of these codons can…

Q: Which of the following statements concerning translation is NOT correct? O a. The first codon of…

A: Translation is the process of translating codons on mRNA into proteins. mRNA bind to ribosomes which…

Q: For a transmembrane protein in the plasma membrane, where in the cell is its translation initiated?…

A: Introduction Plasma Membrane is the outer membrane of animal cell. It is a semi permeable membrane.…

Q: Identify all enzymes used with their corresponding function in the phases of translation of…

A: The central dogma is a process where a flow of genetic information is conducted from DNA to RNA.…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: You have isolated a new organism from a sulfur hot springs in Yellowstone and are investigating its…

A: Option b

Q: You are observing the translation process in a eukaryotic cell that has been exposed to an unknown…

A: Translation is the process by which the genetic information encoded in mRNA is used to synthesize…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Which of the following statements describes the function of the sigma factor in prokaryotic…

A: Transcription in prokaryotes: It is the process of production of RNA by using DNA as template. In…

Q: Please describe the four-step process of the elongation during protein translation in bacteria.

A: Translation is  the process of formation of proteins from mRNA with the help of ribosomes in the…

Q: For translation, identify two things that happen during each step - initiation, elongation and…

A: Translation is a complex process it is the final formation of protein with the help of m RNA, t RNA…

Q: Which of the following statements is/are TRUE about the difference between prokaryotic and…

A: Introduction Translation is the process by which protein is synthesized with the help of…

Q: 1. Using the table of the genetic code, determine the sequence of amino acids. 2. If mutation occurs…

A: Codons are triplets of nucleotides in the mRNA sequence, which is read by the ribosomes in order to…

Q: ic code helps for protein synthesis.

A: Ribosomes are known as minute particles which consist of RNA and  the associated proteins that…

Q: After translation a protein needs to be folded correctly in order to function properly: C) What…

A: Proteins are long chains of amino acids. There are 4 types of proteins based on their structure:…

Q: translation to the plasma membrane

A: Translation is a process in which mRNA is decoded into short peptide sequences made of amino acids.…

Q: Transcription and translation are separate processes in gene expression; however, they have…

A: In living organisms, the genetic instructions for growth, development, functioning, and reproduction…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: What distinguishes proteins that will be released into the cytoplasm after translation from proteins…

A: Protein synthesised in cytoplasm enters the endoplasmic reticulum via pores and is modified there.…

Q: List two essential role of ribosomes during translation?

A: Ribosome is a membrane less cell organelle which contains two sub-units, one .large and one small.

Q: What are the specific steps of eukaryotic translation? Be sure in your discussion that you include…

A: In transcription, a cell “copies” DNA sequence to a complementary RNA molecule. Then, in…

Q: The 3 major forms of RNA (mRNA, tRNA, & rRNA) interact during translation. a) Describe the role…

A: Translation is the process of synthesizing a protein from the mRNA. The genetic information in the…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Describe the differences in translation initiation between prokaryotes and eukaryotes?

A: Translation in terms of biology refers to the process by which the RNA (ribonucleic acid)…

Q: Researchers are studying the mechanism of the antibiotic chloramphenicol. They know that it prevents…

A: The protein is synthesized by the process of translation. It takes place in cytoplasm of cell.

Q: What are the three stages of translation? Discuss the main events that occur during these three…

A: A protein is an important functional biomolecule. The process of synthesis of protein from a…

Q: Describe the prokaryotic translation initiation shown in the diagram. Define the convention of…

A: In bacteria initiation factor are required .Initiation factor 3(IF3) prevents 30S subunit binding to…

Q: The eukaryotic cell is different from the prokaryotic cell. Outline the structural difference…

A: Cells  They are the basic, fundamental entity of life.

Q: Determine which amino acid is formed from the following mRNA codon: GUA.     a aspartic acid b…

A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…

Q: Answer the following questions regarding the diagram (below) showing translation. The ribosome is…

A: This is the concept of molecular biology and the topic is TranslationTranslation is the process in…

Q: Answer the following questions regarding the diagram (below) showing translation. The ribosome is…

A: What stage of translation is shown?The diagram shows the elongation stage of translation. During…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: Answer based on the question above: You have isolated a new eukaryotic microorganism and want to…

A: Introduction  The genetic code is a set of rules or  laws that define how DNA's four-letter code is…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.