Translation Use this genetic code table for some of the questions ahead. You do not need to memorize the code, except for the start codon (AUG = Met) and the stop codons (UAA, UAG, UGA). ABCD U A) C A G U UUU Phe F) UUC - UUA Leu L) UUG - CUU Leu (L) CCU Pro (P) CUC. CCC " CUA CUG - I AUU lle (1) AUC AUA " AUG Met (M) GUU Val (V) GUC - GUA GUG. " The Genetic Code C A UCU Ser (S) UAU Tyr (Y) UCC UCA " UAC - UCG - CCA CCG # . UAA Stop UAG Stop ACU Thr (T) AAU Asn (N) ACC ACA " ACG AAC AAA Lys (K) AAG. CAU His (H) " CAC - CAA Gln (Q) CAG GCA " GCG " GCU Ala (A) GAU Asp (D) GCC - GAC - GAA Glu (E) GAG. G UGU Cys (C) UGC - UGA Stop UGG Trp (W) CGU Arg (R) CGC CGA CGG " . " AGU Ser (S) AGC . AGA Arg (R) AGG GGU Gly (G) GGC GGA GGG 38. Which of the following statements about the genetic code is correct? All codons specify more than one amino acid. The genetic code is redundant. C) All amino acids are specified by more than one codon. D) All codons specify an amino acid. .

Q: if there are multiple start condo, how can you identify the real start codon? a) By observing…

A: The DNA or RNA sequence consists of three nucleotides and determines the particular amino acid that…

Q: how many codons would exist in a genetic code that was four bases long (instead of three)

A: DNA consists of four different bases, and the codon is four bases long. So, there will. be 44 number…

Q: 64 codons specify 20 amino acids. There are two characteristics of codons: 1. No ambiguity: Each…

A: Genetic code is the sequence of nucleotides which specify amino acids.

Q: Now we need to know which amino acid the tRNA is carrying. We can do this on paper using the…

A: Strand mRNA codon tRNA anti-codon AA(short) AA(full name) Strand1: C-G-T-T-A-T-C-T-C-A-T-A-G-C-T…

Q: Several different nucleic acids are involved in the process of getting a protein produced from a…

A: Sense strand is that strand of DNA double helix which has the translatable protein code in the 5'-3'…

Q: acid   (b) the genetic code can mutate

A: Introduction : The DNA molecule which is the genetic material, is converted to mRNA by the process…

Q: Question 1: Define and give an example of the following: Codon, Start Codon, Anticodon, and Stop…

A: In molecular biology,  translation is the process by which the data stored in mRNA is converted into…

Q: Match the function in translation to each type of RNA (one RNA has two listed functions). 1) Carry…

A: The process where RNA transformed into protein called translation. There are all three types of…

Q: They are related in str They have identical ba C) they are the result of a

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: 3) During charging of tRNAS Select an answer and submit. For keyboard navigation, use the up/down…

A: The translation is a process by which proteins are synthesized. It is the last step of the central…

Q: Consider a portion of a gene in a cell with the sequence TTTTT. Which of the following bases would…

A: The correct answer is C) A-A-A-A-A; nucleus .

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: A DNA codon has the sequence GAT. What is the resulting tRNA anti-codon in the translation process…

A: Codon  is a sequence of three  nucleotides present in DNA or mRNA (messenger RNA) molecule that…

Q: The amino acids listed above that are coded by the mRNA codon

A: Protein synthesis is a major process inside our body .Our body has complex system for protein…

Q: How many amino acids are coded for by one codon? O a) 1 O b) 2 O c) 3 O d) 4

A: The sequence of three nucleotides of DNA and RNA is known as Codon. There are 64 different codons…

Q: Part of being a detective is being able to decode secret messages left behind by certain…

A: The given DNA sequence is: 5'- TATGCTAGGCATTGTCGTAGGCATACG -3' 3'- ATACGATCCGTAACAGCATCCGTATGC -5'

Q: A eukaryotic mRNA has 1066 total nucleotides. 50 of these are the 5'UTR and 50 of these are the…

A: In a mature transcript, there are 5' untranslated (UTR) regions and 3' UTR which do not code for any…

Q: and each codon is made up of three nucleotide bases. How might an extra single base INSERTION into…

A: Any abrupt changes in DNA nucleotide is called muttaion.Depending on where the changes occurred…

Q: An RNA molecule has the following percentages of bases: A = 27%, U = 38%, C=20%, G= 15%. (A) Is this…

A: DNA is composed of nucleotide. In nuclear tide there is one ribose sugar, one phosphate  molecule…

Q: The Human Genome Project showed that human DNA is not considerably bigger than much simpler…

A: A genome is all the DNA in an organism, including its genes. Genes carry information for making all…

Q: Choose a pentapeptied composed of five different amino acids.  List the five amino acids.…

A: mRNA strand is synthesized from the template strand of the DNA by transcription. This mRNA is…

Q: Here is our DNA sequence: T-A-C-A-T-G-T-T-T-A-G-G-T-C-C-A-C-C-C-G-T-G-G-G-A-C-T Write the RNA…

A: Introduction  The process by which the genome's DNA is copied in cells is known as DNA replication.…

Q: How many codons would exist in a genetic code that had codons that were four bases long? Why? (show…

A: The rules governing the encoding of genetic information in the DNA of living things are known as the…

Q: Discuss the following statement: “from the nucleotide sequence of a cDNA clone, the complete amino…

A: The proteins are the polymer of amino acids. They play an important role in the cell, by catalyzing…

Q: Use your genetic code (codon) table to answer the next two questions: What type of mutation would…

A: The answer to the above question is given below.

Q: Second base of codon U A G UCU Phenylalanine UAU UUU UGU Cysteine U Tyrosine tyr y UUC phe F UCC UAC…

A: A) The Adenine (A) is present in the intron or non-coding part of the gene, transcription results in…

Q: is the MINIMUM number of tRNA's needed to recognize all of the codons for glutamate (Glu)

A: Deoxyribonucleic Acid (DNA) is made up of four main bases, also known as nucleotides. These are -…

Q: The human genome has 3.3 billion bases, of which 3% codes for protein. If a codon were four letters…

A: In most organisms, genetic information is stored in the form of the nucleotide sequence of DNA. This…

Q: What does it mean when we say the genetic code is redundant?     a)  A single codon can specify…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: Most amino acids are coded for, by more than one codon. Consequently the genetic code is…

A: Introduction: The genetic code is a set of laws that define how DNA's four-letter code is translated…

Q: During planetary exploration a new life form is discovered which has a DNA genome containing 6…

A: A genetic code is defined as the blueprint for the synthesis of proteins. Normally, three nucleotide…

Q: DNA gene TAC AGC TTT mRNA codon (No thymine in RNA!)       tRNA anticodon (No thymine in…

A: According to Bartleby guidelines, the first three questions have been answered. Kindly post the…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: Which of the following mRNA codons could be changed to a stop codon by a single base pair…

A: A codon consists of three-nucleotides (A, G, C, or U) of RNA and carries the genetic information.…

Q: You’re working in Marshall Nirenberg’s lab, trying to decipher the genetic code. You use several…

A: Marshall Nirenberg studied the genetic codes for protein synthesis in his biochemical research. He…

Q: If a protein is made up of 1000 amino acids   1) How many nucleotides will its mRNA contain…

A: Amino acids are the building blocks of proteins, which are responsible for the expression of genes.…

Q: Compare the codons with a pyrimidine, either U or C, as the second base. Do the majority of the…

A: Codons are the trinucleotide sequence of DNA or RNA that codes for specific amino acids. There are…

Q: look at the code: import random # Define the DNA nucleotides nucleotides = ["A", "T", "G", "C"] #…

A: import random# Define the DNA nucleotidesnucleotides = ["A", "T", "G", "C"]The above code  defines…

Q: Choose any pentapeptide composed of five different amino acids.  List the amino acids.  Present one…

A: INTRODUCTION In cells, messenger RNA is a molecule that transports information from the nucleus to…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.