Use this genetic code table for some of the questions ahead. You do not need to memorize the code, except for the start codon (AUG = Met) and the stop codons (UAA, UAG, UGA).Which of the following statements about the genetic code is correct?A) All codons specify more than one amino acid.B) The genetic code is redundant.C) All amino acids are specified by more than one codon.D) All codons specify an amino acid. TranslationUse this genetic code table for some of the questions ahead. You do not need to memorize the code,except for the start codon (AUG = Met) and the stop codons (UAA, UAG, UGA).UCAGUCUUU Phe F) UCU Ser (S)UUCUCCUUA Leu (L)UCAUUGUCGCUU Leu (L)CUCCUACUG"IAUU lle (I)AUCAUA "IAUG Met (M)GUU Val (V)GUCGUAGUG11The Genetic Code11CCU Pro (P)CCCCCACCGACU Thr (T)ACC "IACAACG11GCU Ala (A)GCCGCAGCG11"IAUAU Tyr (Y)UACUAA StopUAG StopCAU His (H)CACCAA Gln (Q)CAG11AAA Lys (K)AAGGUGU Cys (C)UGC -GAU Asp (D)GACGAA Glu (E)GAGUGA StopUGG Trp (W)CGU Arg (R)CGCCGACGG IIAAU Asn (N) AGU Ser (S)AACAGCAGA Arg (R)AGGGGU Gly (G)GGCGGAGGG"IAll amino acids are specified by more than one codon.All codons specify an amino acid.11II11111138. Which of the following statements about the genetic code is correct?A) All codons specify more than one amino acid.B)The genetic code is redundant.

Name: Use this genetic code table for some of the questions ahead. You do no
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Use this genetic code table for some of the questions ahead. You do not need to memorize the code, except for the start codon (AUG = Met) and the stop codons (UAA, UAG, UGA).Which of the following statements about the genetic code is correct?A) All

Here, we are going investigate the the universal language for translating hereditary information…

Science

Biology

Translation Use this genetic code table for some of the questions ahead. You do not need to memorize the code, except for the start codon (AUG = Met) and the stop codons (UAA, UAG, UGA). ABCD U A) C A G U UUU Phe F) UUC - UUA Leu L) UUG - CUU Leu (L) CCU Pro (P) CUC. CCC " CUA CUG - I AUU lle (1) AUC AUA " AUG Met (M) GUU Val (V) GUC - GUA GUG. " The Genetic Code C A UCU Ser (S) UAU Tyr (Y) UCC UCA " UAC - UCG - CCA CCG # . UAA Stop UAG Stop ACU Thr (T) AAU Asn (N) ACC ACA " ACG AAC AAA Lys (K) AAG. CAU His (H) " CAC - CAA Gln (Q) CAG GCA " GCG " GCU Ala (A) GAU Asp (D) GCC - GAC - GAA Glu (E) GAG. G UGU Cys (C) UGC - UGA Stop UGG Trp (W) CGU Arg (R) CGC CGA CGG " . " AGU Ser (S) AGC . AGA Arg (R) AGG GGU Gly (G) GGC GGA GGG 38. Which of the following statements about the genetic code is correct? All codons specify more than one amino acid. The genetic code is redundant. C) All amino acids are specified by more than one codon. D) All codons specify an amino acid. .

Translation Use this genetic code table for some of the questions ahead. You do not need to memorize the code, except for the start codon (AUG = Met) and the stop codons (UAA, UAG, UGA). ABCD U A) C A G U UUU Phe F) UUC - UUA Leu L) UUG - CUU Leu (L) CCU Pro (P) CUC. CCC " CUA CUG - I AUU lle (1) AUC AUA " AUG Met (M) GUU Val (V) GUC - GUA GUG. " The Genetic Code C A UCU Ser (S) UAU Tyr (Y) UCC UCA " UAC - UCG - CCA CCG # . UAA Stop UAG Stop ACU Thr (T) AAU Asn (N) ACC ACA " ACG AAC AAA Lys (K) AAG. CAU His (H) " CAC - CAA Gln (Q) CAG GCA " GCG " GCU Ala (A) GAU Asp (D) GCC - GAC - GAA Glu (E) GAG. G UGU Cys (C) UGC - UGA Stop UGG Trp (W) CGU Arg (R) CGC CGA CGG " . " AGU Ser (S) AGC . AGA Arg (R) AGG GGU Gly (G) GGC GGA GGG 38. Which of the following statements about the genetic code is correct? All codons specify more than one amino acid. The genetic code is redundant. C) All amino acids are specified by more than one codon. D) All codons specify an amino acid. .

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…
READ INSTRUCTIONS WND COMPLETE MRNA CODON COLUMN
mRNA sequence of A gene If we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17CàU 36GàA 49GàU 115AàC 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’
Typed explanation only Codons in mRNA molecule and their corresponding amino acids UUU Phenylalanine UAU tyrosine UUA leucine UAA nonsense GCA alanine AAU asparagine AAG lysine UGC cysteine GUU valine UCG, UCU serine Refer to Table 8.2. If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Group of answer choices 5' TGTGCTTTCTTA 3' 3' AGACGTTTCAAT 5' 3' UGUGCAAAGUUA 5' 5' AGAGCTTTGAAT 3' 3' TCTCGTTTGTTA 5'
oseg 1su Third Base ne following questions refer to Figure 17.2, a table of codons. Second Base nnn UUC UAU non Tyr UCC UAC UGA Stop dois UGG UUA JOS UCA UAA ne UUG UCG UAG di dois CCU CAU CGU CUC SIH CGC CCC CAC CUA no7 CGA CCA Old CAA CCG CAG CGG AAU AUC JOS USV AGC ACC AAC AUA ACA AAA AGA AUG Met or Start Lys ACG AAG GCU GAU dsy GGC GUC GCC GAC Ala Gly GUA GCA GAA GGA GUG GCG GAG GGG Figure 17.2 A peptide has the sequence NH2-phe-pro-lys-pro-gly-phe-pro-COOH. Which Of the following sequences in the coding strand Of the DNA could equal the code for this peptide? a. 5' GGG-AAA-TTT-AAA-CCC-ACT-GGG b. 5' TTT-CCC-AAA-CCC-GGG-TTT-CC c. 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG d. 3' UUU-CCC-AAA-GGG-UUU-CCC e. 5' TTT-CCC-AAA-GGG-TTT-CCC
MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.
Answer codon usage based on this description: You have isolated a new eukaryotic microorganism and want to determine the genetic code of its mitochondria. Here are the amino acids encoded after translation of two synthetic mRNAs using mitochondrial extracts from your eukaryote- in this experiment translation can start at any sequence position: RNA: Protein: Tyr-Met-Tyr-Met-Tyr-Met---- UAUAUAUAUAUAUAU--- UAAUAAUAAUAAUAA--- Asn-Asn-Asn-Asn-Asn---- Met-Met-Met-Met-Met---- Based on the results shown here, what can you conclude about the codons in this eukaryote? A. B. C. D. O A O C OD OB AUA Tyr Met Tyr Met UAU Met Tyr Met Tyr AAU Met Trp Asn UAA Asn Asn Asn Asn, STOP or Met Asn, STOP or Met
MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA Codons* (anticodon) tRNA Alanine GCU AGA Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine AAU GAU UGU GAA CAA GGU CAU AUU CUU AAA AUG Isoleucine Leucine Lysine Methionine UUU Phenylalanine Proline CCU UCU Serine ACU UGG Threonine Tryptophan Tyrosine Valine UAU GUA There are 64 codons. Some amino acids have several mRNA codor There is, however, no overlap of codes.
Using the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequence TAC GGA CAC GTT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequence TAC GGA CAC ATT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Type of mutation (highlight all that apply) Frameshift Nonsense Missense Silent Insertion Deletion Substitution
Question Completion Status: Use the codon chart below to help answer the questions: Codons Found in Messenger RNA Second Base U C G Phe Ser Тyr Тyr Stop Cys Cys U Phe Ser Leu Ser Leu Ser Stop Trp Arg. U Arg Arg Arg Leu Pro His Leu C Leu Pro His Pro Gln Leu Pro Gln lle Thr Asn Ser U A lle Thr Asn Ser lle Thr Lys Arg Arg Met Thr Lys Asp Asp Val Ala - Gly Gly Gly Gly Val Ala Val Ala Glu Val Ala Glu A. Transcribe the DNA sequence TACTAAACACCGATT into mRNA (do not include any spaces in your answer): B. Where in a Eukaryotic cell does the process in part A take place? C. Translate the mRNA sequence from above into the amino acid sequence (in your answer, use the 3 letter abbreviations from the table above, and separate each amino acid with a space): D. If a molecule of DNA contains 22% thymine, what percentage of cytosine would it have? Click Save and Submit to save and submit. Click Save All Answers to save all answers. Save All An First Base DCAGD CAGUCAGUCAG Third Base
Add-ons Help Last edit was 4 minutes ago Times New.. - BIUA 11 + Using the table the other page- transcribe the RNA sequence int codons and their amino acids: CAU TTG TAU UTA AAA TGG GCG Translation Mechanics Now that you are an expert code breaker, we can start to talk about thanslation. Let's go over the key players in the process. MRNA. The mRNA is the code that is translated into a functional protein. It is created through transcription and a series of subsequent editing steps, which we have described in detail already. The mature mRNA comprises codons that will code for the production of a protein. lili 日

mRNA sequence of A gene Write the amino acid sequence of the gene A. 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’