In RNA, an atypical base pair is able to form between guanine and uracil. This base pair allows a single tRNA molecule to recognize more than one codon using its one anticodon sequence. It requires a shift in position of the two nucleotides. Guanine and uracil come together in this unusual pair via 2 hydrogen bonds. Based on what you know about hydrogen bond formation and base pairing, draw a guanine nucleotide and a uracil nucleotide hydrogen bound to one another.
Q: In translation of an mRNA into a protein, the first amino acid that is attached to the start codon…
A: In the first step, the information in DNA is transferred to a messenger RNA (mRNA) molecule by a…
Q: The drug, erythropoietin (EPO) is an artificial version of a protein that is naturally produced by…
A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…
Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…
A: Protein is made up of a chain of monomeric subunits called amino acids joined together by peptide…
Q: Which of the following is a feature of tRNA that is important for its function in translation? O The…
A: Ans : Most important feature of tRNA that is important for its function in translation is - the…
Q: Which of the following is true regarding the tRNA structure? The anticodon is found at the 5′ end…
A: The anticodon is found at the 51 end of the tRNA molecule. An amino acid binds to 31 end of the…
Q: Which of the following regions on the tRNA are composed of a sequence of nucleotides? a. anticodon…
A: The tRNA is responsible for transferring amino acids at the site of translation or protein…
Q: Which of the following types of mutations, resulting in a change in the mRNA just after the…
A: The translation process will result in the creation of proteins. The process of protein synthesis is…
Q: In cells, proteins are synthesized from a gene sequence via the process of transcription and…
A: In prokaryotes cell organelles are absent. The genomic DNA of prokaryotes is found in the cytoplasm.…
Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…
A: The proteins are the final end product of a gene that ultimately determine the characteristics of an…
Q: Which of the following is a true statement concerning codons A codon Will be read by RNA…
A:
Q: You may wish to consult the genetic code above to answer the following question. A mutation has…
A: Mutation is the sudden change in the base pair of sequence resulting in altered phenotype. The…
Q: In RNA, an atypical base pair is able to form between guanine and uracil. This base pair allows a…
A: Introduction A Base Pair Is Made Up Of Two Chemical Bases That Are Bound Together To Form A "rung Of…
Q: Which of the following types of mutation that changes the mRNA sequence after the codon that…
A: Frameshift mutation is a type of mutation that changes the reading frame via the indel mutation…
Q: A small section of a gene for a protein has the following nucleotide sequence: CTA TCC CCT ACG TCA…
A: A genetic mutation occurs after the formation of the DNA sequence has been altered. Some mutations…
Q: The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine,…
A: Genetic code is triplet of bases called codon. Genetic code is unambiguous (each triplet specifies…
Q: Which of the following codons is called the start codon?
A: AUG is the Start codon, which codes for Methionine.
Q: Which of the following statements about the genetic code are true and which are false? Correct each…
A: Genetic code is the sequence of nucleotides in the mRNA that determines the sequence of amino acids.…
Q: Which of the following is true regarding the tRNA structure? The anticodon is found at the 5′ end…
A: Answers : The anticodon is found at the 5′ end of the tRNA molecule. Anticodon is found in the…
Q: Sickle cell anemia is the result of a type of mutation in the gene that codes for part of the…
A: Sickle-cell anemia is a genetic disease characterized by the sickle shape of the RBCs. It results in…
Q: A single base substitution mutation is likely to have a less harmful effect when the base change…
A: Point mutations are the mutation which cause change in nucleotide base at specific position . It can…
Q: Some tRNAs can recognize more than one codon because there is a relaxation of the complementation…
A: Translation of mRNA into protein requires a specialized adapter molecule called tRNA and ribosomes.…
Q: All of the following are true about translation EXCEPT _____. as the ribosome moves from codon…
A: Answer :- All of the following are true about translation except - Ribosomal subunits and a…
Q: If the mRNA molecule from your answer to the previous question is going to be translated into a…
A: The gene is the portion of DNA that codes for a specific protein. First, the DNA is converted to…
Q: A point mutation that changes a codon specifying an amino acid into a stop codon is called a
A: Point mutations are those which substitutes one nucleotide (within) a codon into another. Due to…
Q: For the RNA sequence AUUGGCAUCCGAUAA, draw the secondary structure that maximizes its base pairing.
A: RNA molecules usually come as single strands but when left in the environment, they fold themselves…
Q: The genetic code uses combinations of 3 RNA bases as letters, each triplet specifies only one amino…
A: A genetic code is a triplet code of nucleotides that codes for a specific amino acid. It is also…
Q: DNA gene TAC AGC TTT mRNA codon (No thymine in RNA!) tRNA anticodon (No thymine in…
A: According to Bartleby guidelines, the first three questions have been answered. Kindly post the…
Q: Which of the following mRNA codons could be changed to a stop codon by a single base pair…
A: A codon consists of three-nucleotides (A, G, C, or U) of RNA and carries the genetic information.…
Q: A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce…
A:
Q: Which of the following is a true statement concerning RNA? Group of answer choices a. mRNA is single…
A: The RNA or ribonucleic acid is a nucleic acid polymer that it is produced from the DNA by the…
Q: Which of the following statements best explains why there are many more codons than there are amino…
A: The genetic codon is the sequence of three successive nucleotides present in the mRNA that codes…
Q: Describe the effect of this mutation on the amino acid sequence of the beta-gloving polypeptide…
A: Point mutation It refers to the mutation in which the single-nucleotide of the sequence of DNA…
Q: After the entire coding sequence of a protein has been decoded and the peptide chain is synthesized,…
A: Translation is a process of protein synthesis. It is completed in three steps- Initiation…
Q: Imagine that a mutation in a DNA molecule results in the codon CCU being changed to CCC. Both of…
A: In genetic code, the following terms have specific meaning. These are- 1. Unambiguous- Genetic code…
Q: If a TRNA anticodon was GUG, which amino acid would the tRNA carry? Below is a partial genetic code…
A: TRANSLATION It is the process of formation of a polypeptide chain by joining of various amino acids.…
Q: Which of the following statements about codons in prokaryotic cells and eukaryotic cells is correct?…
A: Option D is correct.
Q: The translation of an mRNA begins with the codon AUG, and an initiator tRNA is required to start…
A: The ribosome starts translation, the assembly of a protein out of amino acids, when it encounters…
Q: A particular triplet of bases in the coding sequence of DNA is AAA. The anticodon on the tRNA that…
A: If the template strand of DNA has AAA, it will be transcribed to mRNA as UUU. A tRNA that would…
Q: Which of the following is TRUE in translation? A. Amino acyl TRNA containing one amino acid is…
A: The translation is the process by which amino acids chain or polypeptide chain is produced from the…
Q: If the following changes occurred in the gene, identify the type of mutation and how it would affect…
A: Codon is a triple of nucleotide base pair. Any change in the sequence resulting in altered phenotype…
Q: A gene is a piece of DNA that codes for a protein. Genes are transcribed into mRNA and are on the…
A: Sometimes mutation disrupts protein synthesis by substitution, deletion, or insertion of one or more…
Q: Which of the following is not true of a codon?(A) It may code for the same amino acid as another…
A: The genetic code involves the set of rules determining the conversion of nucleotide sequence into a…
Q: If instead of 20 amino acids there were 200 amino acids, then how many nucleotides would you be…
A: An mRNA directs the insertion of single amino acid to a protein per three nucleotides. A codon is a…
Q: Why are 3 nucleotides needed for a codon? Because one nucleotide is redundant Because…
A: There are five nitrogen bases - adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U).…
Q: Codons The genetic code consists of triplets of nucleotides called codons. Refer to the genetic…
A: Cells are the building blocks of life. They are the constituent structural and functional units of…
Q: Which statement is true regarding the number of start (initiation) and STOP codons in the standard…
A: Genetic code carries the information present in mRNA in the form of nitrogen bases, for the…
Q: A tRNA's anticodon binds to the RNA sequence: 5'-CUA-3'. What is the sequence of the tRNA's…
A: RNA is Ribonucleic acid which is formed from DNA via the process of transcription . It takes place…
Q: help
A: Translation is the process for synthesizing the protein from mRNA by the action of ribosomes. It…
Q: The following pattern has been observed in the genetic code. For many codons, the first base…
A: The genetic code is a three-letter code employed by living cells to translate the information into…
Q: A single base substitution mutation is likely to have a less harmful effect when the base change…
A: A single base substitution mutation is also known as the point mutation which changes a single base…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- The sequence of a polypeptide is determined by the order of codons that specify the amino acids in the polypeptide. How many different sequences of codons can specify the polypeptide sequence methionine-histidine-lysine? (Use the table to find the number of possibilities.) SECOND BASE UAU UACFTyrosine (Tyr) UAA -Stop codon UAG -Stop codon UUUL UGU Cysteine (Cys) UCU uc UCA FSerine (Ser) uca Uuc Phenylalanine (Phe) UUAL Leucine (Leu) CAU CAC CAA Glutamine (Gin) CAGF UGA -Stop codon uaa -Tryptophan (Trp) CGU сос CGA FArginine (Arg) CU CU Histidine (His) CuA FLeucine (Leu) Cua) Proline (Pro) CCA cca AAU Asparagine (Asn) AGU Serine (Ser) AGC AUU ACU ACC Threonine (Thr) AACF AAA AAGLysine (Lys) AUC Fisoleucine (lle) AUA Methionine (Met) AUG - Start codon ACA ACG AGA AGGFArginine (Arg) GU GACAspartic acid (Asp) GGA GAA Glutamic acid (Glu) Gaa) GcU -Valine (Val) G GUA GCA FAlanine (Ala) Glycine (Gly) 8. 1 4 THIRD BASE 2. FIRST BASETranslate the following DNA sequence into a sequence of amino acids: TAC TAA GGA. The genetic code Second letter of codon UAU UUU Phenylalanine UCU UUC Phe) Tytosine (Tyr) UGU Cysteine (Cys) UGC UCC Serine (Ser) UCA UCG CCU UAC UA Stop codon UXG Stop codon 1oG Stop codon UGS Tryptophan (Trp) CGU CC UUA Leucine (Leu) UUG CAU Histidine (His) CAC CUC Leucine (Leu) CUA Proline (Pro) CA Arginine (Arg) CAR Glutamine (Gin) CGA CUG AUU AUC AUA CAG AAU AAC ACU Isoleucine (le) Asparagine (Asn) AGU Serine (Ser) ACC Threonine (Thr) ALA ARC GAU GAC ACA ACC GCO Methicnine: Lysine (Lys) AGA Arginine (Arg) AGS start codon GUU Aspartic acid (Asp)GGU GUC Valine (Val) GUA GCC Alanine (Ala) GO Glycine (Gly GCA GCG GAA Glutamic acid (Glu) GGA GUG GAG GGG methionine-isoleucine-proline. AUG AUU CCU UAC UAA GGA tyrosine-leucine-glycine First letter of codon Third letter of codonUse the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letter
- Consider the following wild-type double-stranded DNA sequence: 5' TATGAA AGT3 non-transcribed strand (sense strand) 5' 3' ATACTTTCA transcribed strand In the space below, write ONE of the possible DNA sequences of the transcribed strand shown above that results from BOTH a single substitution mutation of the first codon following the start codon that would also cause a nonsense mutation. Use the mRNA codon chart in the Appendix of your manual to help you. Answer: CheckA series of tRNAs have the following anticodons. Consider the wobble rules listed in Table and give all possible codons with which each tRNA can pair. Q. 5′ –IAA–3′Consider the following 2 codons sequences. Codon sequence 1: ACU AGA GAU GUC UGC Codon sequence 2: GCG GAG AAA UGG UAU Draw an anti-parallel b-sheet that can be formed between the amino acids from the two codon sequences.
- Which of the lettered arrows in the diagram of translation indicates an amino acid? A/G|G A AUGGG A CWhat RNA base sequence is complimentary to the following DNA base sequence 5'-CATGATTAT-3'? Using the table of codons, give the primary structure of the protein coded for by the RNA sequence: 5’-CCA CGA GGG GAG ACU UAA-3’?Given the following protein, which of the following sequences of TEMPLATE strand DNA would code for it? Pay attention to the polarity of the polypeptide and the strands of DNA that you choose. Use the codon chart to the right. AUG = met AAA = lys GCU = ala | CUU = leu ACU = thr -lys - thr - ala - leu - met (amino end) 5' TAC GAA CGA TGA TTT TAC ATT 3' 5' ATG CTT GCT ACT AAA ATG TAA 3' (carboxyl end) met 5' TAC TTT TGA CGA GAA TAC ATT 3¹' 3' TAC TTT TGA CGA GAA TAC ATT 5¹ 5' ATG AAA ACT GCT CTT ATG TAA 3¹ 3 TAC GAA CGA TGA TTT TAC ATT 5'
- Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG Part of a sequence of DNA from a person with a genetic disease is: TAG TAA CCA CCC AGG The possible codons for some amino acids are shown in the table. Amino acid Codons glycine GGU GGC GGA GGG isoleucine AUU AUC phenylalanine UUU UUC serine UCU UCC UCA UCG Which amino acid is missing from a person with this genetic disease? serine glycine O phenylalanine isoleucineTranslate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'For the m-RNA nucleotide codons given below, what is the corresponding sequence of amino acids? AUG UGU AUA UAU GUA AUC ACC UUC UAU GUA ACA UUU UGG AAC AGC UGC CAU GUA UAC CAG AAA CUU GCA GAG CUG GCU UUG AUA UGA The α-helices are known to contain primarily the amino acids methionine, alanine, leucine, glutamate, and lysine, while β-pleated sheets are known to primarily contain the amino acids tryptophan, tyrosine, phenylalanine, isoleucine, valine, and threonine. Which one of these two types of secondary protein structure is present with this amino acid sequence?