Answered: Unusual bases and non-Watson–Crick base…

Unusual bases and non-Watson–Crick base pairs frequently appear in tRNA molecules. Which base is most likely to pair with hypoxanthine? Draw this base pair.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 14QP: State the properties of the WatsonCrick model of DNA in the following categories: a. number of...

See similar textbooks

Related questions

Q: It is conceivable for codons encoding a single amino acid to share the first two bases while…

A: Protein synthesis occurs in all organisms in two main steps: transcription and translation. DNA…

Q: What amino acid sequence is encoded by the codon sequence ACGCAGCGCCCGGUC? Use the 3 letter…

A: The amino acids are produced by the help of ribosome in the process of translation. In this process…

Q: Now we need to know which amino acid the tRNA is carrying. We can do this on paper using the…

A: Strand mRNA codon tRNA anti-codon AA(short) AA(full name) Strand1: C-G-T-T-A-T-C-T-C-A-T-A-G-C-T…

Q: Three E. coli tRNA molecules with the anticodon sequences CGG, OGG , and UGG are charged with the…

A: During Protein synthesis or translation that occurs in ribosomes, messenger RNA code for an amino…

Q: Ornithine is structurally similar to lysine except ornithine’s side chain is one methylene group…

A: Ornithine plays important role in urea cycle. Ornithine is structurally similar to lysine except…

Q: Describe the anticodon of a single tRNA that could recognize the codons 5′–AAC–3′ and 5′–AAU–3′.…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: How many different sequences are possible for a tripeptide containing one molecule of valine, one…

A: Valine is a nonpolar amino acid with aliphatic R groups, represented by V. Glycine is the simplest…

Q: How does the aminoacyl-tRNA synthetase that attaches the amino acid proline know which tRNA to…

A: tRNA is a small, well-characterized RNA molecule which plays a key role in protein biosynthesis.…

Q: It is possible for the codons for a single amino acid to have the first two bases in common and to…

A: mRNAs contain trinucleotide sequences known as codons. The ani-codon site of the tRNA recognizes the…

Q: There are three termination codons (UAA, UAG, UGA) but usually only one initiation codon (AUG) is…

A: The initiation codon is also referred to as start codon which marks the beginning of the translation…

Q: Representations of sequencing chromatograms for variants of the a chain of human hemoglobin are…

A: The sequencig chromatograms given in question are generated as we conduct Automated DNA sequencing…

Q: Draw the structure of the RNA dinucleotide formed between cytidine-5’-monophosphate and…

A: Nucleic acid can be of 2 types: DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Nucleic acids…

Q: How many different polypeptides would you expect to see synthesized by an in vitro translation…

A: The mRNA is a sequence of ribonucleotides that contains three possible reading frames. Only one…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An R-loop refers to a structure formed by a DNA (deoxyribonucleic acid) and an RNA molecule. As a…

Q: DNA molecules consist of chemically linked sequences of the bases adenine, guanine, cytosine, and…

A: Codon is a base triplet that exists in DNA. DNA gets transcripted to mRNA which then translates to…

Q: A normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this…

A: In the normal hemoglobin molecule protein, has a glutamic acid (an amino acid) at the sixth position…

Q: What is the direct consequence of the hydrophobic effect that stabilizes the double helix

A: Approach to solving the question: Detailed explanation:In an aqueous environment, the hydrophobic…

Q: Assuming the genetic code is a triplet, what effect would the addition or loss of two nucleotides…

A: The process in which the messenger ribonucleic acid (mRNA) molecule sequence is translated to form…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: Ribosomes are the protein synthesizing machinery present in a cell. A protein is synthesized during…

Q: The anticodon loop of one of the tRNA Gly molecules from Escherichia coli is as follows: a)…

A: Anticodon is the sequence of nucleotides which is complementary to the codons. These are found on…

Q: The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…

A: Mutation is the alteration in the genome sequence. It can occur in the genetic code of eukaryotes,…

Q: Give the sequence of unpaired bases that would be sticky with the following sequences:(a) GGTAC (b)…

A: Restriction endonucleases may cut DNA. The ends of the DNA may be blunt or sticky. A straight cut…

Q: Although techniques are available for determining the sequences of amino acids in proteins, it is…

A: It is easier to sequence proteins indirectly by determining the base sequence of the gene for…

Q: The sequence of a polypeptide is determined by the order of codons that specify the amino acids in…

A: Proteins are the ultimate products of the genes. DNA is transcribed into m RNA and this is…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: The bottom peptide segment is found in the secondary structure composed of anti-parallel - sheets.…

Q: What is the significance of the fact that many synonymous codons differ only in the third nucleotide…

A: Codons are the three consecutive nucleotides on mRNA which specify amino acids or stop signal for…

Q: When the amino acid sequences of insulin isolated from different organisms were determined,…

A: CENTRAL DOGMA- It is the process when DNA replicates itself means it will make copies of itself with…

Q: The alpha chain of human hemoglobin has 141 amino acids in a single polypeptide chain. Calculate the…

A: A codon is trinucleotide sequence of bases of DNA or RNA which corresponds to a specific amino acid.…

Q: A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a…

A: Melting temperature is the point at which 50% of double-helical DNA is changed into a…

Q: An exonuclease is an enzyme that sequentially cleaves nucleotides from the end of a polynucleotide…

A: When snake venom phosphodiesterase cleaves a nucleotide from a nucleic acid strand, it leaves the…

Q: What is the order of the polypeptide chain shown in the images provided? Starting at the…

A: Translation is the process of synthesizing proteins from RNA template through series of reactions on…

Q: The nucleoside inosine frequently occurs as the third base in codons. What role does inosine play in…

A: Inosine is the nucleoside made up of ribose and hypoxanthine.

Q: Based on the information in as shown, which single-nucleotide mutationevent is more likely:…

A: A mutation is an alteration in the nucleotide sequence of the genome of an organism, virus, or…

Q: The amino acid glycine is encoded by four codons: GGA, GGC, GGG, and GGU. Which of the following…

A: Glycine is a versatile amino acid with crucial roles in protein synthesis, collagen formation,…

Q: The following nucleotide sequence is found on the template strand of DNA. First, determine the amino…

A: Amino acids are the amine groups consisting of carboxylic acids and a side chain which forms the…

Q: Determine the sequence of amino acids specified by the codons in the following information strand.…

Q: In HbS, the human hemoglobin found in individuals with sickle-cell anemia, glutamic acid at position…

A: Sickle cell anemia is a genetic condition that results from a mutation in the gene that codes for…

Q: He follówing diagram of how protein AWESOME1 binds to it's target DNA, al effects of each of the 5…

A: A mutation is a permanent change in the nucleotide sequence of DNA that can occur during replication…

Q: As described earlier, DNA damage can cause deletion or insertion of base pairs. If a nucleotide base…

A: A mutation will take place when a DNA gene is either damaged or changed so that it alters the…

Question

Unusual bases and non-Watson–Crick base pairs frequently appear in tRNA molecules. Which base is most likely to pair with hypoxanthine? Draw this base pair.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

Three E. coli tRNA molecules with the anticodon sequences CGG, OGG , and UGG are charged with the same amino acid. What is the amino acid ?
If a tRNA molecule carries a glutamic acid, what are the two possible anticodon sequences that it could contain? Be specific about the 5′ and 3′ ends.
The sequence of a polypeptide is determined by the order of codons that specify the amino acids in the polypeptide. How many different sequences of codons can specify the polypeptide sequence methionine-histidine-lysine? (Use the table to find the number of possibilities.) SECOND BASE UAU UACFTyrosine (Tyr) UAA -Stop codon UAG -Stop codon UUUL UGU Cysteine (Cys) UCU uc UCA FSerine (Ser) uca Uuc Phenylalanine (Phe) UUAL Leucine (Leu) CAU CAC CAA Glutamine (Gin) CAGF UGA -Stop codon uaa -Tryptophan (Trp) CGU сос CGA FArginine (Arg) CU CU Histidine (His) CuA FLeucine (Leu) Cua) Proline (Pro) CCA cca AAU Asparagine (Asn) AGU Serine (Ser) AGC AUU ACU ACC Threonine (Thr) AACF AAA AAGLysine (Lys) AUC Fisoleucine (lle) AUA Methionine (Met) AUG - Start codon ACA ACG AGA AGGFArginine (Arg) GU GACAspartic acid (Asp) GGA GAA Glutamic acid (Glu) Gaa) GcU -Valine (Val) G GUA GCA FAlanine (Ala) Glycine (Gly) 8. 1 4 THIRD BASE 2. FIRST BASE
A tRNA has an anticodon sequence 3′– GGU–5′. Identify the amino acidit is carrying?
DNA molecules consist of chemically linked sequences of the bases adenine, guanine, cytosine, and thymine, denoted A, G, C, and T. A sequence of three basesiscalleda codon. A base may appear more than once in a codon. a) How many different codons are there? b) The bases A and G are purines, while C and T are pyrimidines. How many codons are there whose first and third bases are purines and whose second base is a pyrimidine? c) How many codons consist of three different bases?
For the m-RNA nucleotide codons given below, what is the corresponding sequence of amino acids? AUG UGU AUA UAU GUA AUC ACC UUC UAU GUA ACA UUU UGG AAC AGC UGC CAU GUA UAC CAG AAA CUU GCA GAG CUG GCU UUG AUA UGA The α-helices are known to contain primarily the amino acids methionine, alanine, leucine, glutamate, and lysine, while β-pleated sheets are known to primarily contain the amino acids tryptophan, tyrosine, phenylalanine, isoleucine, valine, and threonine. Which one of these two types of secondary protein structure is present with this amino acid sequence?
A series of tRNAs have the following anticodons. Consider the wobble rules listed in Table and give all possible codons with which each tRNA can pair. Q. 5′ –AAG–3′
Draw the structure of the following DNA sequence (5’-AG-3’) hydrogen bonded through Watson-Crick base pairing to the complementary PNA sequence (Cterminus-TC-Nterminus). Make sure to include both the sugar phosphate backbone of your DNA sequence, as well as the peptide backbone of your PNA sequence. DNA: 5’-AG-3’ PNA: (C)-TC-(N)
A DNA codon has the sequence GAT. What is the resulting tRNA anti-codon in the translationprocess (using Watson-Crick base-pairing)?
Which of the molecules of RNA is the most likely to fold into a specific structure as a result of intramolecular (within itself) base-pairing? Explain. 5′-CCCUAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAGGG-3′ 5′-UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG-3′ 5′-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3′ 5′-GGAAAAGGAGAUGGGCAAGGGGAAAAGGAGAUGGGCAAGG-3′
Partial base sequence of an RNA molecule is known as: 5'---AGCU---3'. Write structural formula of the known RNA sequence (AGCU). (Use Haworth projection for sugar.)
The alpha chain of human hemoglobin has 141 amino acids in a single polypeptide chain. Calculate the minimum number of bases on DNA necessary to code for the alpha chain. Include in your calculation the bases necessary for specifying termination of polypeptide synthesis.