The bottom peptide segment is found in the secondary structure composed of anti-parallel - sheets. From the C-terminus of the peptide below, the sequence immediately after alternation contains the following amino acid residues (from N → C) A-F-R-M-Y-A.

Q: Why is it important to identify the N-terminal residue(s) of a protein?

A: Protein is composed of a long chain of amino acids, which are joined by a peptide bond. These…

Q: Using the following sequence and the amino acid chart, please give the amino acid sequence:…

A: The genetic material in majority of complex higher organisms and various viruses is DNA or…

Q: A monomeric protein contains 154 amino acids. How many codons code for these amino acids? How many…

A: Amino acids are joined by peptide bonds to form a polypeptide. A protien is a polymer of many…

Q: the peptide (written N-terminal to C-terminal) represented by Ala-Ser-Ala-Tyr the same as the…

A: Ans. Yes, the polypeptide chain of amino acid will be Similarly in structure and function whether it…

Q: How is the peptide shown named (give each 3-letter name for the amino acids present)? Whichamino…

A: The peptide is made up of amino acid. The sequence of amino acid in this peptide is N - Val-Phe-Trp-…

Q: Which amino acid residue is preferred at which position in the following peptide for cleavage by…

A: While writing a polypeptide, the left side is the N terminus and the right side is the C terminus.

Q: Peptide #1:  L-I-T-V Peptide #2:  C-Q-H-R Peptide #3:  E-G-E-A   Which peptide is the most basic?…

A: Amino acids are the building blocks of protein. An amino acid contains a carboxylic acid and a-amino…

Q: How many amino acids are in KMT2D peptide sequence?

A: Introduction  Organic substances known as amino acids have both functional groups for amino and…

Q: This is the three-letter code for the amino acid that is the most geometrically constricted amino…

A: Amino Acids are the organic compounds that combine to form proteins, hence they are referred to as…

Q: How many ways can four different amino acids be arranged in a peptide so that each peptide is…

A: Amino acids are organic compounds that contain amine (-NH2) and carboxyl (-COOH) functional groups,…

Q: Given the polypeptide chain below: Ala-Arg-Val-His-Asp-Gln 1. What is the N-terminus? 2.What is…

A: The organic molecule is comprised of two functional groups that are an amino group and the carboxyl…

Q: Digestion of a peptide with trypsin generates two smaller peptide products: methionine-glycine and…

A: pepsin is a serine protease that cleaves the bond present in the C-terminal of amino acids Lysine…

Q: Disulfide bonds have been shown to stabilize proteins (i.e., make them less likely to unfold).…

A: Disulfide bonds are considered the covalent bond, which is formed between the two cysteine residues.…

Q: The structures of tRNAs contain several unusual bases in addition to the typical four. Suggest a…

A: The transfer RNA or tRNA acts as an adaptor molecule that is responsible for decoding the codons,…

Q: The 20 different amino acids in the protein are normally coded by ------ nucleotides. * 60 61 62 63

A: Nucleotides are building blocks of nucleic acids. Three mRNA nucleotides present together are known…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: You are studying the toxic protein called ectatomin, a major component of ant venom (specifically…

A: Proteins contain amino acids. They are linked to each other by peptide bonds. The amino acid such as…

Q: What are the sequences of all the possibletripeptides that contain the amino acids aspartic acid,…

A: Amino acids are the building blocks of proteins. They contain amino group, carboxyl group, and…

Q: Part of being a detective is being able to decode secret messages left behind by certain…

A: The given DNA sequence is: 5'- TATGCTAGGCATTGTCGTAGGCATACG -3' 3'- ATACGATCCGTAACAGCATCCGTATGC -5'

Q: Translate this nucleotide sequence into an amino acid sequence. Gene Sequence (5'-to-3'):…

A: Translation is a biological process that converts a nucleotide sequence into an amino acid sequence.…

Q: The adenine derivative hypoxanthine can base-pair with adenine. Draw the structure of this base…

A: A Wobble base pair is the pairing between two nucleotides in RNA molecules that does not follow…

Q: List possible codon sequences for the following amino acids.(a) Val (b) Phe (c) Asn (d) Gly (e) Met

A: Amino acids are coded by trinucleotides sequence is known as the codon. The first two positions in…

Q: How many possible nucleotide sequences could code for a peptide with the sequence "MRRTGERS*"? (Note…

A: The given sequence is 'MRRTGERS*'. The amino acid sequence is…

Q: Draw a peptide bond between Phenylalanine (c-terminus) and Isoleucine (n-terminus).

A: Amino acids are organic compounds with two functional group namely carboxyl and amino. There are 20…

Q: The following RNA: 5 AUGAUAACACUCGUACCUUAAUGUS' in the 5'-3'frame will betranslated into a peptide…

A: The single-stranded ribonucleic acid (RNA) molecule that corresponds to the genetic sequence of a…

Q: Changing one amino acid within a protein sequence from a tryptophan to a stop codon would be best…

A: Mutation is the change in the nucleotide sequence of the DNA that causes a change in the mRNA.…

Q: Where would you expect a polypeptide region Ridge and the amino acid valine, leucine, and isoleucine…

A: Amino acids are the building blocks of life. Proteins are long chains of amino acids that make up…

Q: How do you think incorporating a-methylserine into a peptide would affect the structure and/or…

A: proteins are made up of amino acids . amino acid polarity and peptide struture depends upon the side…

Q: Given the R-groups in the peptide GLY-ASN-THR-LYS-HIS. It would most likely be: a)neither soluble…

A: Different amino acids have different R-groups. The R-groups can be polar or non-polar. Polar…

Q: The amino acid hydroxyproline is found in collagen. There is no codon for hydroxyproline. Explain…

A: Post-translational modification refers to the covalent and enzymatic modification of proteins…

Q: You could use absorbance at 280nm or colorimetric assays like the Bradford assay or bicinchoninic…

A: There are different methods present to measure the concentration of a given protein.

Q: what is the correct way of drawing a peptide backbone?

A: A peptide is a polymer of amino acids. In a peptide, 2 amino acids are linked to each other via a…

Q: Select correct properties of alpha-helices: O A. Small amino acids, glycine and alanine, are…

A: Alpha-helix is a secondary structure that is stabilized by the H-bond. Hydrogen bonds forms between…

Q: For the three peptides below, label whether they would form an amphiphilic beta-strand, amphiphilic…

A: Amphipathic beta-strand: The amphipathic beta-strands consist of a 1-3 amino acid pattern of…

Q: What amino acid would a tRNA with anticodon CUA carry? Enter the 3 letter code only [A]. [e.g. Met…

A: tRNA stands for the transfer RNA and it has L- shaped structure . Transfer RNA acts as an adopter…

Q: The primary amino acid sequence of a stretch of polypeptide is Asp-Glu-Pro-Lys-His-Arg. Would you…

A: Amino acids are biomolecules when combined with a peptide bond forms proteins. Proteins are…

Q: What kind of repeating polynucleotide would yield a single polypeptide with a tetrapeptide repeating…

A: Polynucleotide is a sequence of nucleotides. Nucleotides consist of a sugar molecule, a phosphate…

Q: pH @1 of Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr

A: Peptides are organic compounds made up of amino acids connected by peptide bonds. The specific…

Q: Describe the planar sections of the primary sequence, their influence on the shape of the protein…

A: Amino acids are the building blocks of proteins. These are compounds containing Carbon, Hydrogen,…