Translate this nucleotide sequence into an amino acid sequence. Gene Sequence (5'-to-3'): atggaccacctcggggcgtccctctggccccaggtcggctccctttgtctcctgctcgctggggccgcctgggcgcccccgcctaacctcccggaccccaagttc

Q: This is a homework question that I have on my Adv. Anatomy & Physiology assignment. How to I got…

A: The hypothetical protein considered here consists of the amino acid sequence arginine,…

Q: ONA sequences have an alphabet {A, C,G,T}. How many DNA sequences of length n are there? (Two DNA…

A: Dna is a nucleic acid polymer made of deoxyribonucleotides. It is a bit like a string of letters…

Q: Histidine: draw the amino acid side chain and give the single and three letter abbreviation.

A: Histidine is known as a semi-essential amino acid because it is synthesized in the body in adults…

Q: Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change…

A: Mutations are the abrupt changes in the DNA sequences due to wrong reading of the DNA polymerase…

Q: Does a sequence contain a gene?

A: DNA stands for doexyribonucleic acid which is made up of phosphate group, sugar group and…

Q: How many different DNA sequences could code for amino acid sequence Met-His-Leu-Thr-Trp-Lys?  (Note:…

A: DNA is a hereditary molecule. It carries the genetic information that is passed from one generation…

Q: Which of the following sequences is less favorable to find in a folded beta? Select one:…

A: Two types of secondary structures are abundant in protein: alpha helix and beta sheets.  The alpha…

Q: Obtain the self-dotplot of the following sequence to identify repeat region:…

A: There are various alignment tools available at EMBOSS. It is studied under the domain of…

Q: As a result of the Human Genome Project, we learned that approximately % of "junk" DNA is actually…

A:

Q: Design a pair of primers (22 nucleotides long each) for the following sequence to clone the full…

A: Primer is a short nucleic acid sequence that provides a starting point for DNA synthesis. It is used…

Q: polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…

A: Wild type sequence : Met Ser Pro Arg Leu Glu Gly    Mutant 1: Met Ser Pro   After pro, the peptide…

Q: (i) Indicate by drawing where the RNA of Telomerase binds to the telomeric region. W, X, Y, and Z…

A:

Q: Use the genetic code table to determine the amino acid sequence of the given message strand of DNA…

A: Proteins are made up of amino acids, which are a type of molecule. The basic components of life are…

Q: What does SDS–PAGE stand for? What is the benefit of doing SDS– PAGE?

A: Electrophoresis is the migration of charged particles under the influence of an electric current.…

Q: A compact disc (CD) stores about 4.8 × 109 bits of information in a 96 cm2 area. This information is…

A: The total set of nucleic acid sequences encoded as DNA within the 23 chromosomes is known as the…

Q: If the code were a sextuplet (containing of six nucleotides), would the reading frame be restored by…

A: A frameshift mutation is induced by adding or deleting several nucleotides in a DNA sequence that is…

Q: In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash…

A: DNA is a genetic material in most of the organism. It is two stranded ladder like structure which…

Q: Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of…

A: DNA is a duplex helical molecule, which has complementary base pairs. The complementary strands are…

Q: Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA…

A: Double stranded nucleic acids are formed through hydrogen bonding between complementary nitrogenous…

Q: Below is an image of a basepair and associated ribose rings as viewed down the helical axis in B DI…

A: Introduction: Deoxyribonucleic acid or DNA is a type of molecule known as a nucleic acid that…

Q: explain why the order is 3–1-4-2 and not another way, thank you so much

A: Shotgun sequencing It is a method used in laboratories to identify the DNA sequence of a genome. The…

Q: For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'

A: Polymerase chain reaction (PCR) is a technique to amplify the sequence of DNA. A large quantity of…

Q: What would be the percentage of G, C, A, and T in each column? Have to calculate the nucleotide…

A: Nucleotide frequency is the percentage of each nucleotide (G, C, A, and T) in a DNA or RNA sequence.…

Q: The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using…

A: DNA is a double helical structure with two DNA strands. One strand serves as a template for the…

Q: following sequence please design an 18 base pair REVERSE primer.

A: Primers are short synthesized single-stranded sequences that bind onto the DNA strand by forming…

Q: You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and…

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Q: Transcribe the following DNA sequence.  Then translate the resulting mRNA transcript.…

A: Mutation is any change in the DNA sequence. It can alter the protein sequence because the proteins…

Q: Write the complementary sequence for the following DNA sequence, in order from 3' to 5': Use all…

A: Note that in determining the complementary of a DNA sequence, always remember that adenine (A) pairs…

Q: The mass of RNA that has copied a segment of DNA is 63,000 units. The RNA mass that is placed in the…

A: Here, first we have to calculate the RNA units that will be used for peptide synthesis  so, 60% 0f…

Q: For a closed-circular DNA molecule of 6,825 base pairs in the fully relaxed form, the linking number…

A: In simple words, the linking number represents the number of times a curve winds around another. The…

Q: If a sequence of DNA has 20% Guanine bases how many Adenines would it have? Select one: O a. 10% O…

A: If a sequence of DNA has 20% Guanine bases, then it would have 30% Adenine.   Hence, option (c) is…

Q: You could use absorbance at 280nm or colorimetric assays like the Bradford assay or bicinchoninic…

A: There are different methods present to measure the concentration of a given protein.

Q: Crick and Watson, whose work greatly contributed to the discovery of the double helical structure of…

A: Made by Rosalind Franklin utilizing a procedure called X-beam crystallography, it uncovered the…

Q: look at the code: import random # Define the DNA nucleotides nucleotides = ["A", "T", "G", "C"] #…

A: import random# Define the DNA nucleotidesnucleotides = ["A", "T", "G", "C"]The above code  defines…

Q: Name the second complementary base from the 5' direction. USE ALL CAPITAL LETTERS ONLY. Name the…

A: Nucleic acids are biopolymers made of nucleotides. The nucleotides are in turn made of nucleosides.…

Q: Write the base sequence that would be sticky with the sequence T-A-T-G-A-C-T.

A: Erwin Chargaff discovered the complementary base pair rule. according to the chargeoff base-pairing…

Q: BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would…

A:

Q: lence: -T -G FG -A If RNA primase used this section of DNA to make a primer, what would be the…

A: RNA primase is an enzyme used in DNA replication. It produces RNA primer.

Q: For the following sequence please design an 18 base pair forward primer.…

A: >> To make a primer, the pairing of bases goes as follows: A binds with T and T binds with A G…

Q: Which of the following sequences is less favorable to find in a folded beta? Select one:…

A: Protein structure: Each layer of a protein's structure, which includes multiple different layers,…

Q: a) What is the sequence of the copy and the template strands? b) If the template strand were in the…

A: A DNA primer complementary to the template DNA (the DNA to be sequenced) is used as a starting point…

Q: Define adenine (A)

A: A nitrogenous base is a molecule that mainly contains nitrogen and has the chemical properties of a…