Translate this nucleotide sequence into an amino acid sequence. Gene Sequence (5'-to-3'): atggaccacctcggggcgtccctctggccccaggtcggctccctttgtctcctgctcgctggggccgcctgggcgcccccgcctaacctcccggaccccaagttc

Q: What is the corresponding RNA sequence, if the DNA sequence reads TACACCTGG?

A: The RNA or ribonucleic acid is single stranded macromolecule that is composed of nucleotides. RNA is…

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: This is a homework question that I have on my Adv. Anatomy & Physiology assignment. How to I got…

A: The hypothetical protein considered here consists of the amino acid sequence arginine,…

Q: What amino acid sequence is encoded by the codon sequence ACGCAGCGCCCGGUC? Use the 3 letter…

A: The amino acids are produced by the help of ribosome in the process of translation. In this process…

Q: Using the following sequence and the amino acid chart, please give the amino acid sequence:…

A: The genetic material in majority of complex higher organisms and various viruses is DNA or…

Q: COYOTE: Use your translated amino acid sequences to determine the phenotypes to include in your…

A: Phenotype are the external characteristics of any individual.

Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…

A: The proteins are the final end product of a gene that ultimately determine the characteristics of an…

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: CT/TGT/AAG/ACC/TTT What would be the amino acid sequence created from this mutated DNA strand?

A: The central dogma theory in genetics is based on the processes of Replication, Transcription and…

Q: What is the coordinate for TSS_tra_16584216?

A: Explanation:     The TSS_tra_16584216 is a coordinate that marks the location of the transcription…

Q: The genetic disorder sickle-cell anemia occurs when the amino acid valine takes the place of…

A: Sickle cell anemia is a type of blood related disorder which is also known known as sickle cell…

Q: Draw a ribbon structure for the following polypeptide: (There is more than one right answer to this…

A: The polypeptide in question is likely to form intrastrand antiparallel beta-sheet. Beta-sheets are…

Q: You are studying the toxic protein called ectatomin, a major component of ant venom (specifically…

A: Proteins contain amino acids. They are linked to each other by peptide bonds. The amino acid such as…

Q: Obtain the self-dotplot of the following sequence to identify repeat region:…

A: There are various alignment tools available at EMBOSS. It is studied under the domain of…

Q: For each of the following sequences, fill in either the DNA, the mRNA sequence, or the amino acid…

A: The given mRNA sequence: AUG ACU AGC UGG GGG UAU UAC UUU UAG  The corresponding DNA sequence will be…

Q: Using the genetic code, translate your mRNA sequence of 60 nucleotides into a polypeptide. Use…

A: The genetic material of the cell contains various genes that code for various proteins. This happens…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An R-loop refers to a structure formed by a DNA (deoxyribonucleic acid) and an RNA molecule. As a…

Q: Hello , please help me with this question. I am struggling with naming the Amino Acid sequence from…

A: Codon is the triplet of either DNA or RNA nucleotides which codes for a specific amino acid during…

Q: Can you spell your name (or someone else's) using the one-letter amino acid abbreviations? If so,…

A: The RNA is formed from the DNA by the process of transcription. The protein is formed from the RNA…

Q: How many possible nucleotide sequences could code for a peptide with the sequence "MRRTGERS*"? (Note…

A: The given sequence is 'MRRTGERS*'. The amino acid sequence is…

Q: If the code were a sextuplet (containing of six nucleotides), would the reading frame be restored by…

A: A frameshift mutation is induced by adding or deleting several nucleotides in a DNA sequence that is…

Q: In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash…

A: DNA is a genetic material in most of the organism. It is two stranded ladder like structure which…

Q: Give the amino acid sequence with some little explanation please.   5′…

A: Decoding a sequence of bases in mRNA results in the formation of either peptide, polypeptide, or…

Q: The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to…

A: Replication is the process of the formation of identical copies of DNA. It takes place in the…

Q: Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and…

A: FGF3 gene is responsible for producing a protein called fibroblast growth factor 3 which is a part…

Q: How do you translate this into amino acid sequence

A: The process of synthesis of protein with the help of messenger RNA is called translation. In the…

Q: If the mRNA molecule from your answer to the previous question is going to be translated into a…

A: The gene is the portion of DNA that codes for a specific protein. First, the DNA is converted to…

Q: For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'

A: Polymerase chain reaction (PCR) is a technique to amplify the sequence of DNA. A large quantity of…

Q: following sequence please design an 18 base pair REVERSE primer.

A: Primers are short synthesized single-stranded sequences that bind onto the DNA strand by forming…

Q: You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and…

A: “Since you have posted multiple questions, we will provide the solution only to the first question…